View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_126 (Length: 339)
Name: NF7829A_low_126
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_126 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 290; Significance: 1e-163; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 1 - 314
Target Start/End: Complemental strand, 23332908 - 23332595
Alignment:
| Q |
1 |
tggtgtgcatgttgatgattatgtcatgttgcgtgatccaaacagaaacatgttcgaggtcaaggtccacgtgaaaaatggcaaggtctatctgcgggat |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
23332908 |
tggtttgcatgttgatgattatgtcatgttgcgtgatccaaacagaaacatgttcaaggtcaaggtccacgtgaaaaatggcaaggtttatctgcgggat |
23332809 |
T |
|
| Q |
101 |
ggttgggctgagctgaagggtttctataaggtagatcgtggtgcgtgggtcaccctgacttatgtacagccgaatcttctagatatgactatcgcagaga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332808 |
ggttgggctgagctgaagggtttctataaggtagatcgtggtgcgtgggtcaccctgacgtatgtacagccgaatcttctagatatgactatcgcagaga |
23332709 |
T |
|
| Q |
201 |
gatcaggagtcgaaatcaactatcctaacaaatttcttcctcccatgtcgaaaatgattgtccaacgtgagggtggatcggtcatgcgcttctatcgctc |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332708 |
gatcaggagtcgaaatcaactatcctaacaaatttcttcctcccatgtcgaaaatgattgtcccacgtgagggtggatcggtcatgcgcttctatcgctc |
23332609 |
T |
|
| Q |
301 |
attcgtccacatat |
314 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
23332608 |
attcgtccatatat |
23332595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 10955082 - 10955166
Alignment:
| Q |
1 |
tggtgtgcatgttgatgattatgtcatgttgcgtgatccaaacagaaacatgttcgaggtcaaggtccacgtgaaaaatggcaaggt |
87 |
Q |
| |
|
|||| |||| |||||||| |||||||| |||||||||| |||| |||||||||||||| ||||||||| ||| || |||||||| |
|
|
| T |
10955082 |
tggtttgcacgttgatgactatgtcat--tgcgtgatcctaacaagaacatgttcgaggttaaggtccacaagaagaagggcaaggt |
10955166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 20 - 87
Target Start/End: Complemental strand, 2027759 - 2027692
Alignment:
| Q |
20 |
tatgtcatgttgcgtgatccaaacagaaacatgttcgaggtcaaggtccacgtgaaaaatggcaaggt |
87 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||| ||||| || || ||| ||||||||||||||| |
|
|
| T |
2027759 |
tatgtcattttgcgtgatccaaacaagaacatgtttgaggttaaagttcacaagaaaaatggcaaggt |
2027692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University