View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_136 (Length: 329)
Name: NF7829A_low_136
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_136 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 27 - 329
Target Start/End: Complemental strand, 19159382 - 19159080
Alignment:
| Q |
27 |
caaggaggttcaaggtttcagaggtacagacagtctagggttagggataggtcaggtttcgtgtatcaccacagacgtccagattggcagcaatattatt |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| || ||||||||||||||| ||||||| |
|
|
| T |
19159382 |
caaggaggttcaaggtttcagaggtacagatagtctagggttagggttaggtcaggtttcgtgtatcaccacaaacatccagattggcagcagtattatt |
19159283 |
T |
 |
| Q |
127 |
ccgataagaacaacttctttgatcagcacagtttcgatgaatttccctatgcaagggcagtctgatcgagagataccatggtcctacgcgatggtggtta |
226 |
Q |
| |
|
|||||||| | ||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| | |||||||||||||| |
|
|
| T |
19159282 |
ccgataaggataacttctttgatcagcacaatttcgatgaatttccctatgcaagggcaggacgatcgagagataccatggtcttgcgcgatggtggtta |
19159183 |
T |
 |
| Q |
227 |
tcaggtgcataatcatacgcgttccaattatcgttcctacgggaaggagaatgtgcaccctgtggataccattgaggctgatcacatgaaataaaggaag |
326 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| |||||| |||||| ||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
19159182 |
tcaggtgcaaaatcatacgcgttccaattatcgttcctacgggaaagagaatatgcaccatgtggataccattgaggttgatcacgtgaaataaaggaag |
19159083 |
T |
 |
| Q |
327 |
gta |
329 |
Q |
| |
|
||| |
|
|
| T |
19159082 |
gta |
19159080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University