View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_152 (Length: 316)
Name: NF7829A_low_152
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_152 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 40 - 316
Target Start/End: Original strand, 5950630 - 5950906
Alignment:
| Q |
40 |
ggacatcattgaaataggacatccacaacatagcttgtgaagggaaaaagaagacgtaccatggtgccagcgatatccatttgatatgtcatcagctcta |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5950630 |
ggacatcattgaaataggacatccacaacatagcttgtgaagggaaaaagaagacgtaccagggtgccagcgatatccatttgatatgtcatcaactcta |
5950729 |
T |
|
| Q |
140 |
ttgactgcacccgacaatgattcttgtgacgatgaaacagaagagacagagggaaaatgatgataacgacgaggacttgcattattctcgtcgtctggat |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
5950730 |
ttgactgcacccgacaatgattcttgtgacgatgaaacagaagagacagagggaaaatgatgataacgacgaggacttgcattattctcgtcgtcttgat |
5950829 |
T |
|
| Q |
240 |
aactgttcgtcctatctggaagtagcattgatatctctgcttcaatcatagtagcaatttcagaaggatcccaattt |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5950830 |
aactgttcgtcctatctggaagtagcattgatatctctgcttcaatcatagtagcaatttcagaaggatcccaattt |
5950906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University