View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_174 (Length: 300)
Name: NF7829A_low_174
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_174 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 1 - 292
Target Start/End: Complemental strand, 48623327 - 48623037
Alignment:
| Q |
1 |
tcagtttctaacagtagggaaatagttgcttgttaaacttagttagattcggaattgagtattgcattttttgtggagaaaaacgaaagatggatctgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48623327 |
tcagtttctaacagtagggaaatagttgcttgttaaacttagttagattcggaattgagtattgcattttttgtggagaaaaacgaaagatggatctgta |
48623228 |
T |
|
| Q |
101 |
tattaagctcgggcaacttagtaatcactgcagtgttttcttcatgataaatatttgttttgtaggcatatttcatcacgaatatggaacctataaagtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48623227 |
tattaagctcgggcaacttagtaatcactgcagtgttttcttcatgataaatatttgttttgtaggcatatttcatcacgaatatggaacctataaagtt |
48623128 |
T |
|
| Q |
201 |
ttgggagttcatgtctctaattttggaaggtcttgggtatcaaaggtgatttcttttgtactgttaaccattaggtctttcttgctcttatt |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
48623127 |
ttgggagttcatgtctctaattttggaaggtcttggatatcaaaggtgatttcttttgtactgttaaccatta-gtctttcttgctcttatt |
48623037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University