View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7829A_low_182 (Length: 296)

Name: NF7829A_low_182
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7829A_low_182
NF7829A_low_182
[»] chr3 (1 HSPs)
chr3 (199-248)||(54235487-54235536)
[»] chr6 (1 HSPs)
chr6 (119-184)||(7310976-7311041)


Alignment Details
Target: chr3 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 199 - 248
Target Start/End: Original strand, 54235487 - 54235536
Alignment:
199 ttgccgtcacccgctgcggttgtctccgccgcttacctctctcttcaacc 248  Q
    |||||||||||||||||||||||||||||||| ||| |||||| ||||||    
54235487 ttgccgtcacccgctgcggttgtctccgccgcctacgtctctcctcaacc 54235536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 119 - 184
Target Start/End: Original strand, 7310976 - 7311041
Alignment:
119 ccagaaaatcaaaccctctccgatccacctgacttcagcgtcgttgattccgatctcgtcgtcatc 184  Q
    |||||||||||||||||||||||  ||||||||| || |||| || |||| ||| ||||| |||||    
7310976 ccagaaaatcaaaccctctccgactcacctgactccaccgtcattaattctgatttcgtcatcatc 7311041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University