View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_183 (Length: 296)
Name: NF7829A_low_183
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_183 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 287
Target Start/End: Original strand, 6815783 - 6816069
Alignment:
| Q |
1 |
tcatatggaataaagtggtgtcttttaaagtgtctcttttagtatgaagattgttgaattaaagactttcaactaaatataatttaattcatcatggagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6815783 |
tcatatggaataaagtggtgtcttttaaagtgtctcttttaatatgaagattgttgaattaaagactttcaactaaatataatttaattcatcatggagt |
6815882 |
T |
|
| Q |
101 |
tcttcaaccaagatcgttgttatgctcgggtgattgtgggatggtagaatgtggtgaatcatgtcttcttggatttcgannnnnnngggaagtagtttgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6815883 |
tcttcaaccaagatcgttgttatgctcgggtgattgtgggatggtagaatatggtgaatcatgtcttcttggatttcgatttttttgggaagtagtttgg |
6815982 |
T |
|
| Q |
201 |
tccttcgttttaaagtggttaggtatatctagcgtgcttttatctgatattggtttgcaatctactcagttggatgatgtccatctc |
287 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||| |||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
6815983 |
tccttcgttttgaagtggttagggatatctagcgtgctttcatctgatattggtttgcaatcttctcagttggatggtgtccatctc |
6816069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University