View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_187 (Length: 295)
Name: NF7829A_low_187
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_187 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 5 - 291
Target Start/End: Complemental strand, 28551173 - 28550887
Alignment:
| Q |
5 |
taaattatactcgagtcatcgtaatctattgaaccgtatgaatatctcgtgtaagattattacctgtgaaaagagatcatgtcttatgtgcaagaatgag |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28551173 |
taaattatactcgagtcatcgtaatctattgaaccgtatgaatatctcgtgtaagattatcacctgtgaaaagagatcatgtcttatgtgcaagaatgag |
28551074 |
T |
 |
| Q |
105 |
tctacgaacgatccaacaagacaaccatctgggatcttagaggaaattcgcaattggcgtgaagatgagatagagtctctagcacattaattcagtttta |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28551073 |
tctacgaacgatccaacaagacaaccatctgggatcttagaggaaattcgcaattggcgtgaagatgagatagattctctagcacattaattcagtttta |
28550974 |
T |
 |
| Q |
205 |
ttgaaatgtgtttaatatggcatgaaccttgtaatttttaaacatcaataatacttcactttcctttttgttgggacggtgcatgtg |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28550973 |
ttgaaatgtgtttaatatggcatgaaccttgtgatttttaaacatcaataatacttcactttcctttttgttgggacggtgcatgtg |
28550887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University