View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_188 (Length: 295)
Name: NF7829A_low_188
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_188 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 287
Target Start/End: Original strand, 16294352 - 16294638
Alignment:
| Q |
1 |
tcaaggaaagacgaggttgtaatgtgtatgacagcccagcaacatgaaccatatatttatgagaaaagtaaaataaacaacgttattaccaccaacatgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16294352 |
tcaaggaaagacgaggttgtaatgtgtatgacagcccagcaacatgaaccttatatttatgagaaaagtaaaataaacaacgttattaccaccaacatgg |
16294451 |
T |
 |
| Q |
101 |
aaaccactcattaatggtttttatgtctcttgaaaggtagctgtttgagctactttcagatatcctcttttagtgatagtaacaaaattgttgtgtaaac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
16294452 |
aaaccactcattaatggtttttatgtctcttgaaaggtagctgtttgagctactttcagatatcctcttttagtgatagtaacaaaattgttgtgtacac |
16294551 |
T |
 |
| Q |
201 |
caatagctatgtctatgataaaagctcaaatgaatgaaattgcaaagtttgaagaagttgaattgagtctcagtaacatcaacacca |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
16294552 |
caatagctatgtctatgataaaagctcaaatgaatgaaattgcaaagtttgaagaagttgaattgagtctcaataacatcaccacca |
16294638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University