View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7829A_low_196 (Length: 290)

Name: NF7829A_low_196
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7829A_low_196
NF7829A_low_196
[»] chr2 (2 HSPs)
chr2 (99-290)||(41686472-41686663)
chr2 (99-290)||(18317240-18317417)
[»] chr1 (4 HSPs)
chr1 (99-187)||(7149629-7149717)
chr1 (225-290)||(49210095-49210160)
chr1 (225-290)||(49665398-49665463)
chr1 (225-290)||(49708955-49709020)
[»] chr4 (1 HSPs)
chr4 (106-187)||(8476797-8476878)


Alignment Details
Target: chr2 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 99 - 290
Target Start/End: Complemental strand, 41686663 - 41686472
Alignment:
99 tcagcaaaattttgtctttgaccctctcttgtctcttccgtctcccttccttcaccctgtcctttctgccccaccgccgccgccaacacccatcctcata 198  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||||||    
41686663 tcagcaaaattctgtctttgaccctctcttgtctcttccgtctcccttccttcaacctgtcctttctgccccaccaccgccgccaacacctatcctcata 41686564  T
199 cccatcattccttcatttagttgtggtatcatctttcctttcactactacagaacttcaggattgtgatttattgccaatacctaactgtga 290  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41686563 cccatcattccttcatttagttgtggtatcatatttcctttcactactacagaacttcaggattgtgatttattgccaatacctaactgtga 41686472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 99 - 290
Target Start/End: Original strand, 18317240 - 18317417
Alignment:
99 tcagcaaaattttgtctttgaccctctcttgtctcttccgtctcccttccttcaccctgtcctttctgccccaccgccgccgccaacacccatcctcata 198  Q
    ||||| ||||||||||||||||||||||  |||||||||||||||||||||||||| |||||||||   |||||| |||| |||||||||||||||        
18317240 tcagcgaaattttgtctttgaccctctc--gtctcttccgtctcccttccttcaccatgtcctttccatcccaccaccgctgccaacacccatcct---- 18317333  T
199 cccatcattccttcatttagttgtggtatcatctttcctttcactactacagaacttcaggattgtgatttattgccaatacctaactgtga 290  Q
            ||||||||||||||||||||||| |||||||||||| || |||||||| ||||||||||| |||||||||||||||||||||||    
18317334 --------tccttcatttagttgtggtatcagctttcctttcaccaccacagaactccaggattgtgacttattgccaatacctaactgtga 18317417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 53; Significance: 2e-21; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 99 - 187
Target Start/End: Original strand, 7149629 - 7149717
Alignment:
99 tcagcaaaattttgtctttgaccctctcttgtctcttccgtctcccttccttcaccctgtcctttctgccccaccgccgccgccaacac 187  Q
    |||||||||||||||||||| ||||||||||||||||  ||||||||||||| ||| |||||||||  ||||||| |||| ||||||||    
7149629 tcagcaaaattttgtctttggccctctcttgtctcttgtgtctcccttcctttaccttgtcctttccaccccaccaccgctgccaacac 7149717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 225 - 290
Target Start/End: Original strand, 49210095 - 49210160
Alignment:
225 tatcatctttcctttcactactacagaacttcaggattgtgatttattgccaatacctaactgtga 290  Q
    ||||| ||||||||||||||| |||||||  ||||| ||||  ||||||||||||||| |||||||    
49210095 tatcagctttcctttcactaccacagaacgccaggactgtggcttattgccaatacctgactgtga 49210160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 225 - 290
Target Start/End: Original strand, 49665398 - 49665463
Alignment:
225 tatcatctttcctttcactactacagaacttcaggattgtgatttattgccaatacctaactgtga 290  Q
    ||||| ||| ||||||||||| |||||||  ||||| ||||  |||||||||||||||||||||||    
49665398 tatcagcttccctttcactacaacagaacgccaggactgtggcttattgccaatacctaactgtga 49665463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 225 - 290
Target Start/End: Original strand, 49708955 - 49709020
Alignment:
225 tatcatctttcctttcactactacagaacttcaggattgtgatttattgccaatacctaactgtga 290  Q
    ||||| ||| ||||||||||| |||||||  ||||| ||||  |||||||||||||||||||||||    
49708955 tatcagcttccctttcactacaacagaacgccaggactgtggcttattgccaatacctaactgtga 49709020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 106 - 187
Target Start/End: Complemental strand, 8476878 - 8476797
Alignment:
106 aattttgtctttgaccctctcttgtctcttccgtctcccttccttcaccctgtcctttctgccccaccgccgccgccaacac 187  Q
    |||||||| | ||||||||| || ||||||| ||| || |||||||||||| || |||||| || |||||||||||||||||    
8476878 aattttgtttgtgaccctcttttctctcttctgtcacctttccttcaccctatcttttctgaccgaccgccgccgccaacac 8476797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University