View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_197 (Length: 289)
Name: NF7829A_low_197
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_197 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 32 - 271
Target Start/End: Complemental strand, 9700434 - 9700195
Alignment:
| Q |
32 |
cctgtgaaaatgaagtgattgacgcaacatccccactccaattaaatcccttatcttgcgaactttttggcatacggccttctaaataatctgacaatat |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9700434 |
cctgtgaaaatgaagtgattgacgcaacatccccactccaattaaatcccttatcttgcgaactttttggcatacggccttctaaataatctgacaatat |
9700335 |
T |
|
| Q |
132 |
gatacttggaagaccattccttttggtgatctgtctctttttaggatcataattagaaatcaggcattcaacaaaatgcttaacagctgcataagcacgt |
231 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9700334 |
gatacttggaagaccattccttctggtgatctgtctctttttaggatcataattagaaatcaggcattcaacaaaatgcttaacagctgcataagcacgt |
9700235 |
T |
|
| Q |
232 |
ttccagttgcctgaaaaatataaaaataacaatgcggcgt |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9700234 |
ttccagttgcctgaaaaatataaaaataacaatgcggcgt |
9700195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University