View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_220 (Length: 279)
Name: NF7829A_low_220
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_220 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 273
Target Start/End: Original strand, 3272143 - 3272419
Alignment:
| Q |
1 |
taatgagctctctagaattaatcgttcaggaaaaactaagttcgatttctagtaaaaataattattggtcagactttatttaccttctaaccgaaccgga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3272143 |
taatgagctctctagaattaatcgttcaggaaaaactaagttcgattcctagtagaaataattattggtcagactttatttaccttctaaccgaaccgga |
3272242 |
T |
|
| Q |
101 |
ttgctagggcctctttccctaaaaaccggagggttaacacaa----annnnnnnnnnngacaaacagtgtggtttcatgttttttacatcatataacagc |
196 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3272243 |
ttgctagggcctcttcccctaaaaaccggagggttaacacaattttttttttttttttgacaaacagtgtggtttcatgttttttacatcatataacagc |
3272342 |
T |
|
| Q |
197 |
aatttcacaagcaatgtggttagatagattgttcaaaagaaagcattttctttgaagggagttttacattctgtttt |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3272343 |
aatttcacaagcaatgtggttagatagattgttcaaaagaaaccattttctttgaagggagttttacattctgtttt |
3272419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 39 - 87
Target Start/End: Original strand, 577417 - 577465
Alignment:
| Q |
39 |
agttcgatttctagtaaaaataattattggtcagactttatttaccttc |
87 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||| |||| |||||||| |
|
|
| T |
577417 |
agttcgattcgtagtgaaaataattattggtcagattttacttaccttc |
577465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University