View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_235 (Length: 270)
Name: NF7829A_low_235
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_235 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 4 - 266
Target Start/End: Original strand, 6637806 - 6638068
Alignment:
| Q |
4 |
ccatgatcattagcatgcatacaacaaatatacttgttaaatggccttcctctaccttaaatactatcaatgacccaagggcatcacttaaacttacaac |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6637806 |
ccatgatcattagcatgcatacaacaaatatacttgttaaatggccttcctctaccttaaatactatcaatgacccaagggcatcacttaaacttacaac |
6637905 |
T |
|
| Q |
104 |
attatcacttaatgaggttggacagtctaaaaaatatagaatatgttgtgacgtgtaacatgctattgatattacgattagaagcaaatttattttatag |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6637906 |
attatcacttaatgaggttggacagtctaaaaaatatagaatatgttgtgacgtgtaacatgctattgatattacgattagaagcaaatttattttatag |
6638005 |
T |
|
| Q |
204 |
atatggtccccagagaacacttccttcaagattactttcgcaaaataaagcacatcaatgacg |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6638006 |
atatggtccccagagaacacttccttcaagattactttcgcaaaataaagcacattaatgacg |
6638068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University