View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_256 (Length: 261)
Name: NF7829A_low_256
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_256 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 9 - 255
Target Start/End: Original strand, 43953610 - 43953856
Alignment:
| Q |
9 |
aagaatatggtcaagcctgagtgtggtttaatggcagcggctactaaacaagtgccaagagaaattcatggacggactaacttaagtcaaattgtgttgg |
108 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43953610 |
aagaatatggtcaagcctgaatgtggtttaatggcggcggctactaaacaagtgccaagagaaattcatggacggactaacttaagtcaaattgtgttgg |
43953709 |
T |
|
| Q |
109 |
acacaaacaagtgcatattcggatggatccaatgaggcatatctatccaacaaaaggtggtggttaataaacaagtaccattataattgcccatgctgtt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43953710 |
acacaaacaagtgcatattcggatggatccaatgagacatatctatccaacaaaaggtggtggttaataaacaagtaccattataattgcccatgctgtt |
43953809 |
T |
|
| Q |
209 |
ggcaaaaaggcaaggagactagcaaagatgtctccaacagtgaggct |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43953810 |
ggcaaaaaggcaaggagactagcaaagatgtctccaacagtgaggct |
43953856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University