View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_264 (Length: 258)
Name: NF7829A_low_264
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_264 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 4 - 254
Target Start/End: Complemental strand, 36268938 - 36268687
Alignment:
| Q |
4 |
ggtgttgggctaatagattgaggtcgactgcttgataatatttgtcggaaggttggggatgagtcttctactctgttttggaatgatccttggttggatg |
103 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
36268938 |
ggtgttgcgctagtagattgaggtcgactgcttgataatatttgtcggaaggttggtgatgagtcttctactttgttttgaaatgatccttggttggatc |
36268839 |
T |
 |
| Q |
104 |
gtagatctttgaaagatagttttagaagtttgtttgagttagctgataacaaattggcaacagtcgcggagatgttttctttgggttggggagtgaatga |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36268838 |
gtagatctttgaaagatagttttagaagtttgtttcagttagctgataacaaattggcaacggtcgcggaaatgttttctttgggttggggagtgaatga |
36268739 |
T |
 |
| Q |
204 |
cgaggcct-gaagtagcgtatgaggttgcttgaaagtagcagtcaataatca |
254 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
36268738 |
cgaggcttaaaagtagcgtatgaggttgcttgaaagtagcaatcaataatca |
36268687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University