View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_278 (Length: 251)
Name: NF7829A_low_278
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_278 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 16 - 238
Target Start/End: Original strand, 48998606 - 48998826
Alignment:
| Q |
16 |
tggacatcaacatcagttaactattgtttccagtaggttgttagaaaacaataaatgtgtacatttcaaaactatgtctagatttaagttgcaagctcag |
115 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
48998606 |
tggacaccaacatcagttaactattgtttcctgtagattgttagaaaacaataaatgtgtacatttcaaaactatgtctagatttaagttgcaagc--ag |
48998703 |
T |
|
| Q |
116 |
acatttgattcaatttcattctcaaagtttgcagctgacatttgattcaagtacattatgcaaatggagtttcatttcaaaatgagtttatttattgaat |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
48998704 |
acatttgattcaatttcattctcaaagtttgcagctgacatttgattcaagtacattatgcaaatggagtttcatttgaaaatgagtttatttattgaat |
48998803 |
T |
|
| Q |
216 |
gcgaaattttatttctacaacca |
238 |
Q |
| |
|
|| |||||||||||||||||||| |
|
|
| T |
48998804 |
gcaaaattttatttctacaacca |
48998826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University