View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7829A_low_292 (Length: 250)

Name: NF7829A_low_292
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7829A_low_292
NF7829A_low_292
[»] chr2 (1 HSPs)
chr2 (1-238)||(40688205-40688442)


Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 40688442 - 40688205
Alignment:
1 attagaggcattcataaaggatctaacatattgaatgatgggagcataagggtgaatgtatataggattattccttacactcagattctatcagattgga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||    
40688442 attagaggcattcataaaggatctaacatattgaatgatgggagcataaggatgagtgtatataggattattccttacactcagattctatcagattgga 40688343  T
101 gatagtcttgcagttagattcacaaatggcttccttaaaaccgttactccaatatcccaagtgatcaaaaccaaactatgagcaaaattgcatgtaattc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
40688342 gatagtcttgcagttagattcacaaatggcttccttaaaaccgttactccaatatcccaagtgatcagaaccaaactatgagcaaaattgcatgtaattc 40688243  T
201 cacatcgatattataagtatagtcaataacctaatatt 238  Q
     |||||||||||||||||||||||||||||||||||||    
40688242 aacatcgatattataagtatagtcaataacctaatatt 40688205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University