View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_295 (Length: 250)
Name: NF7829A_low_295
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_295 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 7 - 237
Target Start/End: Complemental strand, 9477650 - 9477420
Alignment:
| Q |
7 |
caatgagatggacatcaccagaagtagatgatgaagcttgaaaggttcgattttgagaattgggaataaagggttttgttgagttgaggcgaagagagtt |
106 |
Q |
| |
|
|||||| ||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
9477650 |
caatgacatgaatatcaccagaagtagatgatgaagcttgaaaggttcgattttgagaattgggaataaagggttttgttgagttgaggcgaagagggtt |
9477551 |
T |
|
| Q |
107 |
ggaaaatgaagatgggttgttacggaaaaggattgagaattgacgaggatgtgaaaagagagagaaagaagggagtttggggaaattgcaagataaagat |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9477550 |
ggaaaatgaagatgggttgttacggaaaaggattgagaattgaagaggatgtgaaaagagagagaaagaagagagtttggggaaattgcaagataaagat |
9477451 |
T |
|
| Q |
207 |
gaaaactttgggtttagaattgatttcattg |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
9477450 |
gaaaactttgggtttagaattgatttcattg |
9477420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University