View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_297 (Length: 250)
Name: NF7829A_low_297
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_297 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 1 - 162
Target Start/End: Complemental strand, 54828176 - 54828018
Alignment:
| Q |
1 |
ggtggccaggcaatttttctttgatcttatcaagtatacccttcttctcatgagttggctcagctgggtgatgggttgcagttgccgtagggtggtgacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54828176 |
ggtggccaggcaatttttctttgatcttatcaagtatacccttcttctcaagagttggctcagctgggtgatgggttgcagttgccgtagggtggtgacc |
54828077 |
T |
 |
| Q |
101 |
tgcacctggaatactggttgcactattatgctcctccttgttgcctcctcctacacctggaa |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
54828076 |
tgcacctggaatactggttgcactattatgc---tccttgttgcctcctcctacacctggaa |
54828018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University