View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_298 (Length: 250)
Name: NF7829A_low_298
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_298 |
 |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
| [»] scaffold0049 (1 HSPs) |
 |  |  |
|
| [»] scaffold0258 (1 HSPs) |
 |  |  |
|
| [»] scaffold0057 (4 HSPs) |
 |  |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |  |
|
| [»] scaffold0311 (1 HSPs) |
 |  |  |
|
| [»] scaffold0187 (2 HSPs) |
 |  |  |
|
| [»] scaffold0180 (1 HSPs) |
 |  |  |
|
| [»] scaffold1176 (1 HSPs) |
 |  |  |
|
| [»] scaffold0223 (1 HSPs) |
 |  |  |
|
| [»] scaffold0018 (1 HSPs) |
 |  |  |
|
| [»] scaffold0954 (1 HSPs) |
 |  |  |
|
| [»] scaffold0254 (1 HSPs) |
 |  |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |  |
|
| [»] scaffold0167 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 58)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 39123854 - 39124081
Alignment:
| Q |
1 |
gggtggctcaatgataaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcg |
100 |
Q |
| |
|
||||||| ||||| |||||||| || ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39123854 |
gggtggcgcaatggtaaagttgttgtcatgtgactgaaacgacacgggttcaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcg |
39123953 |
T |
 |
| Q |
101 |
taaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttttaggcccatgtggtgttgtgtat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39123954 |
taaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccaagctgcccttttaggcccatgtggtgttgtgtat |
39124053 |
T |
 |
| Q |
201 |
ttatgctcttgaagagttaacagtatat |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
39124054 |
ttatgctcttgaagagttaacagtatat |
39124081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 15 - 179
Target Start/End: Original strand, 40463855 - 40464013
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || |||||||||| || | ||||||| |||||| ||||||| ||||||||||||||||| ||||| |||||||||| ||||||||||| |
|
|
| T |
40463855 |
taaagttgttgtcatgtgactgtaaggtcacgggttcaagtcatagaaacagtctcttgtgtaaaaactgggta----aggctgcgtataatacaccaaa |
40463950 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |||||||||| |||||||||| |
|
|
| T |
40463951 |
--tggtgggaccccttctcggaccctgcgtatgcgggagcttcagtgcaccgagttgccctttta |
40464013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 16 - 177
Target Start/End: Original strand, 47716438 - 47716596
Alignment:
| Q |
16 |
aaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
||||||| || |||||||||| || | ||||||| |||||||| ||||| | |||||||||||||| ||||||| |||||||||| |||||||||| |
|
|
| T |
47716438 |
aaagttgttgccatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta----aggctgcgtacaatacaccaat |
47716533 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
||||||||||||||||||||||||| || |||| |||||||||||||||||| | |||||||| |
|
|
| T |
47716534 |
aatggtgggaccccttcccggaccccgcatatgcgggagctttggtgcaccgggttgcccttt |
47716596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 15 - 178
Target Start/End: Original strand, 42805502 - 42805662
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || |||||||||| || | ||||||| |||||||| ||||| | |||||||||||||| ||||||| |||||| ||| |||||||||| |
|
|
| T |
42805502 |
taaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta----aggctgtgtacaatacaccaa |
42805597 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||||||||||||||||||| || |||| ||||||||| |||||||| | ||||||||| |
|
|
| T |
42805598 |
taatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
42805662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 15 - 179
Target Start/End: Complemental strand, 21172164 - 21172007
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||| ||||||| | ||||||| |||||||| ||||| | ||||||||||||| ||||||| |||||||||| ||||||||||| |
|
|
| T |
21172164 |
taaagttgttgtcatgtaactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa-cagggta----aggctgcgtacaatacaccaaa |
21172070 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||| | |||||||| | |||||||||| |
|
|
| T |
21172069 |
--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttta |
21172007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 15 - 178
Target Start/End: Original strand, 43557450 - 43557611
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || ||||||||||||| | || |||| |||||||| ||||| | |||||||||||||| ||| ||| |||||||||| |||||||||| |
|
|
| T |
43557450 |
taaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaaaaacagagta----aggctgcgtacaatacaccaa |
43557545 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagc-tttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||| |||||| ||| |||||||| | ||||||||| |
|
|
| T |
43557546 |
taatggtgggaccccctcccggactctgcgtatgcgggagcttttagtgcaccgggttgccctttt |
43557611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 15 - 178
Target Start/End: Original strand, 32758239 - 32758395
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||||||||||| | ||| ||| |||||||| ||||| | ||||||||||||| ||||||| |||||| ||| ||||||||||| |
|
|
| T |
32758239 |
taaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaa-cagggta----aggctgtgtacaatacaccaaa |
32758333 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||| | |||||||| | ||||||||| |
|
|
| T |
32758334 |
--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
32758395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 27 - 178
Target Start/End: Complemental strand, 42391243 - 42391099
Alignment:
| Q |
27 |
catgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggacc |
126 |
Q |
| |
|
||||||||||||| | ||||||| |||||||| ||||| | |||||||||||| ||||||| |||||||||| ||||||||||| |||||||||| |
|
|
| T |
42391243 |
catgtgactgaaaggtcacgggttcaagtcctggaaacagcttcttgtgtaaaa-cagggta----aggctgcgtacaatacaccaaa--tggtgggacc |
42391151 |
T |
 |
| Q |
127 |
ccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||||||||||| |||| ||||||| | |||||||| | ||||||||| |
|
|
| T |
42391150 |
ccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
42391099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 15 - 177
Target Start/End: Complemental strand, 10693228 - 10693073
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||||||||||| | ||||||| |||||||| ||||| | ||||||||||||| |||||| |||||||||| ||||||||||| |
|
|
| T |
10693228 |
taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaag-agggta----aggctgcgtacaatacaccaaa |
10693134 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||| | |||||| | | |||||||| |
|
|
| T |
10693133 |
--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcactgggttgcccttt |
10693073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 89 - 178
Target Start/End: Complemental strand, 27889402 - 27889315
Alignment:
| Q |
89 |
gggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| ||||| | ||||||||| |
|
|
| T |
27889402 |
gggaaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgcgggagctttggtacaccgggttgccctttt |
27889315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 15 - 166
Target Start/End: Complemental strand, 2541177 - 2541030
Alignment:
| Q |
15 |
taaagttggtggcatgtgactg-aaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacacca |
112 |
Q |
| |
|
|||||||| || |||||||||| ||| | ||||||| |||||||| ||||| | |||||||||||||| ||||||| |||||||||| |||||||| |
|
|
| T |
2541177 |
taaagttgttgtcatgtgactggaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta----aggctgcgtactatacacca |
2541082 |
T |
 |
| Q |
113 |
aaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
|| ||||||||||||||||||| ||||||||||| ||||||||| |||||||| |
|
|
| T |
2541081 |
aa--tggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccg |
2541030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 43 - 178
Target Start/End: Original strand, 7879644 - 7879774
Alignment:
| Q |
43 |
cacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctg |
141 |
Q |
| |
|
||||||| |||||||| ||||| ||||||||||||||| || |||| |||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7879644 |
cacgggttcaagtcctggaaacaatctcttgtgtaaaaaacaaggta----aggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctg |
7879737 |
T |
 |
| Q |
142 |
cgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||| |||||||| |||||||| | ||||||||| |
|
|
| T |
7879738 |
cgtatgcgggagcttcagtgcaccgggttgccctttt |
7879774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 15 - 165
Target Start/End: Complemental strand, 33872066 - 33871922
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||||||||||| | | ||||| |||||||| ||||| |||||||||||||||||| || |||||||||| ||||||||||| |
|
|
| T |
33872066 |
taaagttgttgtcatgtgactgaaaggtcgcgggttcaagtcctggaaacaacctcttgtgtaaaaacaggata----aggctgcgtacaatacaccaaa |
33871971 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcacc |
165 |
Q |
| |
|
||||||||||||||||| ||||||| ||||| | ||||||| ||||||| |
|
|
| T |
33871970 |
--tggtgggaccccttcccagaccctgtgtatgcgagagctttagtgcacc |
33871922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 43 - 164
Target Start/End: Complemental strand, 18512581 - 18512466
Alignment:
| Q |
43 |
cacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgc |
142 |
Q |
| |
|
||||||| |||||||| ||||| ||||||||||||| |||||| |||||||||| |||||||| || |||||||||||||||||||||||||| |
|
|
| T |
18512581 |
cacgggttcaagtcctggaaacaacatcttgtgtaaaaatagggta----aggctgcgtacaatacaccgaa--tggtgggaccccttcccggaccctgc |
18512488 |
T |
 |
| Q |
143 |
gtatgagggagctttggtgcac |
164 |
Q |
| |
|
||||| |||||||||||||||| |
|
|
| T |
18512487 |
gtatgcgggagctttggtgcac |
18512466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 15 - 166
Target Start/End: Complemental strand, 22699127 - 22698978
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || ||||||||||||| | | |||| |||||||| |||| |||||||||||||||| ||||||| || ||||||| |||||||||| |
|
|
| T |
22699127 |
taaagttgttgtcatgtgactgaaaggttatgggttcaagtcctggaaatagtctcttgtgtaaaaaacagggta----agactgcgtacaatacaccaa |
22699032 |
T |
 |
| Q |
114 |
aaatggtgggaccc-cttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||| ||||||| | |||||||| |
|
|
| T |
22699031 |
aaatggtgggacccttttcccggaccctgtgtatgcgggagctatagtgcaccg |
22698978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 15 - 178
Target Start/End: Original strand, 27629612 - 27629770
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || ||| |||| |||| | ||||||| |||||||| ||||| | |||||||||||||| ||||||| ||| ||||||||||||||||| |
|
|
| T |
27629612 |
taaagttgttgtcatttgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta----aggttgcgtaaaatacaccaa |
27629707 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
| ||||||||||||||||||| |||||| |||| || ||||| |||||||| | ||||||||| |
|
|
| T |
27629708 |
a--tggtgggaccccttcccgggccctgcatatgcggtagcttcagtgcaccgggttgccctttt |
27629770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 15 - 178
Target Start/End: Original strand, 42798647 - 42798805
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || |||||||||| || | ||||||| |||||| | ||||| |||||||||||||||| || |||| |||||||||| |||||||||| |
|
|
| T |
42798647 |
taaagttgttgtcatgtgactggaaggtcacgggttcaagtcttggaaacagtctcttgtgtaaaaaacaaggta----aggctgcgtacaatacaccaa |
42798742 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
| ||||||||||| |||||||||||||| |||| ||||||| | ||||| || | ||||||||| |
|
|
| T |
42798743 |
a--tggtgggaccctttcccggaccctgcatatgcgggagctatagtgcatcgggttgccctttt |
42798805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 15 - 178
Target Start/End: Original strand, 19265793 - 19265949
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || || |||||||||| | ||||||| |||||| | || || | | |||||||||||| |||||| |||||||||| ||||||||||| |
|
|
| T |
19265793 |
taaagttgttgtcacgtgactgaaaggtcacgggttcaagtcttggatacagccgcttgtgtaaaaagagggta----aggctgcgtacaatacaccaaa |
19265888 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||||||||||||||| ||| | |||| ||||||||| |||||||| ||||||||||| |
|
|
| T |
19265889 |
--tggtgggaccccttcccgga-cctacatatgtgggagctttagtgcaccgggctgccctttt |
19265949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 27 - 176
Target Start/End: Original strand, 29907409 - 29907552
Alignment:
| Q |
27 |
catgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggacc |
126 |
Q |
| |
|
||||||||||||| | ||||||| |||||||||||||| | |||||||||||||| | || | |||||||||| |||||||||||| |||||||||| |
|
|
| T |
29907409 |
catgtgactgaaaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaaa-atagt--gtaaggctgcgttcaatacaccaaaa-tggtgggacc |
29907504 |
T |
 |
| Q |
127 |
ccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctt |
176 |
Q |
| |
|
|| ||||||||||| ||||| ||||||||| |||||||| | ||||||| |
|
|
| T |
29907505 |
ccatcccggaccct--gtatgcgggagctttagtgcaccgggttgccctt |
29907552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 15 - 178
Target Start/End: Complemental strand, 34626364 - 34626207
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||||| ||||| | ||| | | |||||||| ||||| | ||| ||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
34626364 |
taaagttgttgtcatgtgattgaaaggccacagattcaagtcctggaaacagcctcctgtgtaaaaacagggta----aggctgcgttcaatacaccaaa |
34626269 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||| || || || | ||||||||| |
|
|
| T |
34626268 |
--tggtgggatcccttcccggaccctgcgtatgcgggagctttagttcatcgggttgccctttt |
34626207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 15 - 177
Target Start/End: Complemental strand, 48735278 - 48735122
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctag-aaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || ||||||||||||| | ||||||| |||||||| | |||| ||||||||||||| || |||| |||||||||| |||||||||| |
|
|
| T |
48735278 |
taaagttgttgtcatgtgactgaaaggtcacgggttcaagtccttggaaacaacctcttgtgtaaaa-cacggta----aggctgcgtacaatacaccaa |
48735184 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
| |||||||||||||||||||||||||| |||| ||||||| | |||||||| | |||||||| |
|
|
| T |
48735183 |
a--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
48735122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 15 - 176
Target Start/End: Complemental strand, 11617745 - 11617589
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || ||||||||||||| | ||| ||| |||||||| ||||| |||||||||||||| ||||||| || ||||||| |||||||||| |
|
|
| T |
11617745 |
taaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacaacctcttgtgtaaaaaacagggta----agactgcgtacaatacaccaa |
11617650 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctt |
176 |
Q |
| |
|
| |||||||||||||||| |||||||||||||| ||| |||| |||||||| | ||||||| |
|
|
| T |
11617649 |
a--tggtgggaccccttcctggaccctgcgtatgcaggacctttagtgcaccgggttgccctt |
11617589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 15 - 139
Target Start/End: Original strand, 46354172 - 46354293
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || ||||||| || || | ||||||| |||||||| ||||| |||||||||||||| ||||||| |||||||||| |||||||||| |
|
|
| T |
46354172 |
taaagttgttgtcatgtgattggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggta----aggctgcgtacaatacaccaa |
46354267 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccc |
139 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
46354268 |
taatggtgggaccccttcccggaccc |
46354293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 15 - 158
Target Start/End: Complemental strand, 28362302 - 28362164
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || |||||| |||||| | ||| ||| |||||||||||||| | |||||||||||||| | || ||||||||||| ||||||||||| |
|
|
| T |
28362302 |
taaagttgttgtcatgtggctgaaaggtcacaggttcaagtcctagaaactgcctcttgtgtaaaaaac---ttggtaaggctgcgtacaatacaccaaa |
28362206 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttg |
158 |
Q |
| |
|
||||||||||||||||| |||| ||| |||| |||||||||| |
|
|
| T |
28362205 |
--tggtgggaccccttcccagaccttgcatatgtgggagctttg |
28362164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 90 - 165
Target Start/End: Complemental strand, 45019012 - 45018935
Alignment:
| Q |
90 |
ggaaggctgcgtaaaatacaccaaaaa--tggtgggaccccttcccggaccctgcgtatgagggagctttggtgcacc |
165 |
Q |
| |
|
||||||||||||| |||| |||||||| |||||| |||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
45019012 |
ggaaggctgcgtacaatataccaaaaaactggtggaaccccttcccggaccctgcgtatgcgggagctttagtgcacc |
45018935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 4 - 158
Target Start/End: Original strand, 13805069 - 13805217
Alignment:
| Q |
4 |
tggctcaatgataaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaa |
103 |
Q |
| |
|
|||| ||||| |||||||| || ||||||||||||| | |||||| |||||||| |||| | |||| |||||||| ||||| | ||||||| ||| |
|
|
| T |
13805069 |
tggcgcaatggtaaagttgttgtcatgtgactgaaaggtaacgggttcaagtcctggaaatagcctctggtgtaaaa-caggg---gtaaggctgtgtac |
13805164 |
T |
 |
| Q |
104 |
aatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttg |
158 |
Q |
| |
|
||||||||||| |||||||||| ||||| |||||||||||||| |||||||||| |
|
|
| T |
13805165 |
aatacaccaaa--tggtgggaccacttcctggaccctgcgtatgcgggagctttg |
13805217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 43 - 176
Target Start/End: Original strand, 16341284 - 16341413
Alignment:
| Q |
43 |
cacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctg |
141 |
Q |
| |
|
||||||| ||||| |||||||| | |||||||||||||| ||||||| ||||| |||| |||||||||||| ||||||| || ||||||||||| |
|
|
| T |
16341284 |
cacgggttcaagttctagaaacagcctcttgtgtaaaaaacagggta----aggctacgtacaatacaccaaaa-tggtgggccctcttcccggacctat |
16341378 |
T |
 |
| Q |
142 |
cgtatgagggagctttggtgcaccgagctgccctt |
176 |
Q |
| |
|
| |||| |||||||||||||||||| ||||||||| |
|
|
| T |
16341379 |
catatgcgggagctttggtgcaccgggctgccctt |
16341413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 92 - 176
Target Start/End: Original strand, 18747539 - 18747621
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctt |
176 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||| | |||||||||||| ||||||||| |||||||| ||||||||| |
|
|
| T |
18747539 |
aaggctgcgtataatacaccaat--tggtgggaccccttcctgaaccctgcgtatgcgggagctttagtgcaccgggctgccctt |
18747621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 68 - 157
Target Start/End: Original strand, 38604558 - 38604641
Alignment:
| Q |
68 |
ctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagcttt |
157 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||| ||||| |||||||| |||||||||||||||| ||||||||| |
|
|
| T |
38604558 |
ctcttgtgtaaaaacagggta----aggctgcgtacaatacaccaaa--tggtgagacccctttccggaccctgcgtatgcgggagcttt |
38604641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 15 - 162
Target Start/End: Complemental strand, 3469336 - 3469190
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa---cagggtagggaaggctgcgtaaaatacacc |
111 |
Q |
| |
|
|||||||| || ||||||||||||| | ||| | |||||||||||||| ||||||||||||||| ||||||| || |||||| |||||||| |
|
|
| T |
3469336 |
taaagttgttgtcatgtgactgaaaggtcacagactcaagtcctagaaacattctcttgtgtaaaaaaaacagggtacggt----tgcgtacaatacacc |
3469241 |
T |
 |
| Q |
112 |
aaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgc |
162 |
Q |
| |
|
|||||||| |||||||||||| ||||||| ||||| ||||||||| |||| |
|
|
| T |
3469240 |
aaaaatggcgggaccccttcctagaccctgtgtatgcgggagctttagtgc |
3469190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 31 - 178
Target Start/End: Complemental strand, 32233275 - 32233134
Alignment:
| Q |
31 |
tgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggacccctt |
130 |
Q |
| |
|
||||||||| | || |||| |||||||| ||||| ||||||||||||||||||||| |||| ||||| | ||||||||| |||||||| |||| |
|
|
| T |
32233275 |
tgactgaaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaacagggta----aggcagcgtatattacaccaaa--tggtgggattcctt |
32233182 |
T |
 |
| Q |
131 |
cccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||| ||||||| ||||||||||||| |||||||| ||||||||||| |
|
|
| T |
32233181 |
cccaaaccctgcatatgagggagcttcagtgcaccgggctgccctttt |
32233134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 15 - 166
Target Start/End: Complemental strand, 35334971 - 35334827
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || |||||||||| || | |||| || |||||||| ||||| ||||| ||| |||||||||||| || ||| ||| |||||||| || |
|
|
| T |
35334971 |
taaagttgttgtcatgtgactggaaggtcacgagttcaagtcctggaaacagtctcgtgta-aaaaacagggta----agactgtgtacaatacaccgaa |
35334877 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
35334876 |
--tggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcaccg |
35334827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 114 - 178
Target Start/End: Complemental strand, 13792213 - 13792149
Alignment:
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||| ||||||||||| || |||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
13792213 |
aaatggcgggaccccttctcgaaccctgcgtatgctggagcttttgtgcaccgagctgccctttt |
13792149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 15 - 178
Target Start/End: Complemental strand, 19427046 - 19426889
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgta-aaaacagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || |||||||| |||| | ||||||| |||||||| ||||| | |||||||||| |||| ||||| ||| ||||||| |||||||| |
|
|
| T |
19427046 |
taaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaatagggt----aagactgcgtacaatacacc-- |
19426953 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||||| |||||| |||||||||| |||| | |||||| |||||||| | ||||||||| |
|
|
| T |
19426952 |
aaatggtggga-cccttctcggaccctgcatatgcgagagcttcagtgcaccgggttgccctttt |
19426889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 90 - 166
Target Start/End: Original strand, 21566485 - 21566560
Alignment:
| Q |
90 |
ggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
||||| ||||||| |||||||||||| |||| ||||||||||||| ||||||| |||| ||||||||| |||||||| |
|
|
| T |
21566485 |
ggaagactgcgtacaatacaccaaaa-tggtaggaccccttcccgaaccctgcatatgcgggagctttagtgcaccg |
21566560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 92 - 179
Target Start/End: Complemental strand, 31591192 - 31591107
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
||||||||||| |||||| | ||||||||||||||||||||||||| ||| |||| ||||||| | |||||||| | |||||||||| |
|
|
| T |
31591192 |
aaggctgcgtacaataca--ataaatggtgggaccccttcccggaccttgcatatgcgggagctctagtgcaccgggttgccctttta |
31591107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 96 - 152
Target Start/End: Original strand, 33500569 - 33500625
Alignment:
| Q |
96 |
ctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgaggga |
152 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33500569 |
ctgcgtactatacacaaaaaatggtgggaccccttcccggaccctgcgtatgcggga |
33500625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 15 - 177
Target Start/End: Complemental strand, 23419831 - 23419674
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || ||||||||| ||| | ||| ||| ||||| || ||||| | |||||||||||||| ||||||| || ||||||| |||||||||| |
|
|
| T |
23419831 |
taaagttgctgtcatgtgactaaaaggtcacaggttcaagttctggaaacagcctcttgtgtaaaaaacagggta----agactgcgtacaatacaccaa |
23419736 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
| |||||||||||||||| |||| ||||| || ||| ||||| ||||| || |||||||||| |
|
|
| T |
23419735 |
a--tggtgggaccccttcctagaccttgcgtgtgcgggggctttagtgcatcgggctgcccttt |
23419674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 68 - 179
Target Start/End: Complemental strand, 35787372 - 35787267
Alignment:
| Q |
68 |
ctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccga |
167 |
Q |
| |
|
|||||||||||||||| |||| ||| |||||| ||||||||||| ||| |||||||||||||||||| |||||||| |||||||| ||||||| |
|
|
| T |
35787372 |
ctcttgtgtaaaaacatggta----aggttgcgtacaatacaccaaa--tggcgggaccccttcccggaccttgcgtatgcgggagcttcaatgcaccgg |
35787279 |
T |
 |
| Q |
168 |
gctgccctttta |
179 |
Q |
| |
|
| |||||||||| |
|
|
| T |
35787278 |
gttgccctttta |
35787267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 15 - 166
Target Start/End: Complemental strand, 47078010 - 47077866
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||||||||||| | ||||||| |||||||| ||||| ||||||||||| |||| || || || | |||||| ||||||| || |
|
|
| T |
47078010 |
taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagtctcttgtgt-aaaatagagt----aaagttgcgtacaatacac--aa |
47077918 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
||||||||||||||||||| ||||| | |||| ||||||| | |||||||| |
|
|
| T |
47077917 |
aatggtgggaccccttcccaaaccctacatatgcgggagctctagtgcaccg |
47077866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 92 - 177
Target Start/End: Original strand, 23231609 - 23231692
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
||||||||||| |||||||| || || ||||||||||||||| |||||||||||| || |||||| |||||||||| | |||||| |
|
|
| T |
23231609 |
aaggctgcgtataatacaccgaa--tgatgggaccccttcccgaaccctgcgtatgcggcagctttagtgcaccgagtttcccttt |
23231692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 92 - 156
Target Start/End: Original strand, 19266502 - 19266564
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctt |
156 |
Q |
| |
|
||||||||||| ||||||||||| | |||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
19266502 |
aaggctgcgtacaatacaccaaa--ttgtgggatcccttcccggaccctgcgtatgcgggagctt |
19266564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 17 - 157
Target Start/End: Complemental strand, 28078286 - 28078152
Alignment:
| Q |
17 |
aagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaa |
116 |
Q |
| |
|
|||||| || |||||||||| || | ||||||| |||||||||||||| ||||| ||| ||||||||||| |||| ||| | |||||||| ||| |
|
|
| T |
28078286 |
aagttgttgtcatgtgactgtaaggtcacgggttcaagtcctagaaacagtctcgtgtaaaaaaacagggt----aaggttgcatgcaatacacc--aaa |
28078193 |
T |
 |
| Q |
117 |
tggtgggaccccttcccggaccctgcgtatgagggagcttt |
157 |
Q |
| |
|
|||||||||||||||||| | ||||| |||| | ||||||| |
|
|
| T |
28078192 |
tggtgggaccccttcccgaatcctgcatatgcgagagcttt |
28078152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 15 - 166
Target Start/End: Complemental strand, 14732979 - 14732832
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || ||||||||||||| | || |||| |||||||| ||||| | ||| |||||||| ||||||| ||||||||| || |||||||| |
|
|
| T |
14732979 |
taaagttgttgtcatgtgactgaaaagtcatgggttcaagtcctggaaacagcctcccatgtaaaaaacagggta----aggctgcgtcaa-tacaccaa |
14732885 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
|||||||| || |||||||| |||||| |||| ||||||||| |||||||| |
|
|
| T |
14732884 |
aaatggtgaaactccttcccgaaccctgtttatgcgggagctttagtgcaccg |
14732832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 166
Target Start/End: Complemental strand, 38262340 - 38262207
Alignment:
| Q |
28 |
atgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtaggg-aaggctgcgtaaaatacaccaaaaatggtgggacc |
126 |
Q |
| |
|
||||||||| || | ||||||| |||||||| ||||| |||||||||||||||| || || || | ||| || ||||||||||| || ||||||| |
|
|
| T |
38262340 |
atgtgactggaaggtcacgggttcaagtcctggaaacagtctcttgtgtaaaaaa----tatggtaatgttgcatacaatacaccaaa--tgatgggacc |
38262247 |
T |
 |
| Q |
127 |
ccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
|||||||| || ||||||||| ||||||||| |||||||| |
|
|
| T |
38262246 |
ccttcccgaacactgcgtatgcgggagctttagtgcaccg |
38262207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 43 - 157
Target Start/End: Original strand, 35203445 - 35203556
Alignment:
| Q |
43 |
cacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctg |
141 |
Q |
| |
|
||||||| |||||||| ||||| ||||||||||||||| |||| || || ||||||| |||| |||||||||||||||| ||||||| | || || |
|
|
| T |
35203445 |
cacgggttcaagtcctggaaacattctcttgtgtaaaaaacaggata----agactgcgtacaatataccaaaaatggtgggatcccttcctgaactcta |
35203540 |
T |
 |
| Q |
142 |
cgtatgagggagcttt |
157 |
Q |
| |
|
|||||| ||||||||| |
|
|
| T |
35203541 |
cgtatgcgggagcttt |
35203556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 15 - 165
Target Start/End: Original strand, 42476851 - 42476994
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||||||| ||| | ||||| | ||||| || ||||| ||||||||||||||| || |||| |||||||||| ||||||||||| |
|
|
| T |
42476851 |
taaagttgttgtcatgtgactaaaaggtcacggattcaagttctggaaacagtctcttgtgtaaaa-caaggta----aggctgcgtacaatacaccaaa |
42476945 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcacc |
165 |
Q |
| |
|
|||||||||||||||| | | |||| |||| ||||||| | ||||||| |
|
|
| T |
42476946 |
--tggtgggaccccttcctaggctctgcatatgcgggagctctagtgcacc |
42476994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 114 - 147
Target Start/End: Original strand, 1408529 - 1408562
Alignment:
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatg |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
1408529 |
aaatggtgggaccccttcccggaccctgcgtatg |
1408562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 134 - 179
Target Start/End: Original strand, 25434112 - 25434157
Alignment:
| Q |
134 |
ggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||| ||||||| |
|
|
| T |
25434112 |
ggaccctgcgtatgcgggagctttagtgcaccgagctgtcctttta |
25434157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 15 - 88
Target Start/End: Complemental strand, 42495992 - 42495919
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggta |
88 |
Q |
| |
|
|||||||| || ||| ||||||||| | ||||||| |||||||| ||||| | ||||||| ||||||||||||| |
|
|
| T |
42495992 |
taaagttgttgtcatatgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaacagggta |
42495919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 126 - 165
Target Start/End: Complemental strand, 42495913 - 42495874
Alignment:
| Q |
126 |
cccttcccggaccctgcgtatgagggagctttggtgcacc |
165 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
42495913 |
cccttcccggaccctgcgtatgcgggagctttagtgcacc |
42495874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 92 - 176
Target Start/End: Original strand, 11741845 - 11741927
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctt |
176 |
Q |
| |
|
||||||||||| ||||||||||| |||||||| ||||||||||| |||| ||| ||||||| | |||||||| | ||||||| |
|
|
| T |
11741845 |
aaggctgcgtacaatacaccaaa--tggtgggatcccttcccggattctgcacatgcgggagctctagtgcaccgggttgccctt |
11741927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 15 - 147
Target Start/End: Complemental strand, 14099163 - 14099036
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || ||||||||||||| | || |||| ||||||| |||| | || ||||||||||| |||| || || ||||||| |||||||||| |
|
|
| T |
14099163 |
taaagttgttgtcatgtgactgaaaggtcatgggttgaagtcctggaaatagccttttgtgtaaaaaacaggtta----agactgcgtacaatacaccaa |
14099068 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatg |
147 |
Q |
| |
|
| |||||||||||||||||| ||||| |||||| |
|
|
| T |
14099067 |
a--tggtgggaccccttcccgaaccctacgtatg |
14099036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 15 - 147
Target Start/End: Complemental strand, 14409180 - 14409053
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || ||||||||||||| | || |||| ||||||| |||| | || ||||||||||| |||| || || ||||||| |||||||||| |
|
|
| T |
14409180 |
taaagttgttgtcatgtgactgaaaggtcatgggttgaagtcctggaaatagccttttgtgtaaaaaacaggtta----agactgcgtacaatacaccaa |
14409085 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatg |
147 |
Q |
| |
|
| |||||||||||||||||| ||||| |||||| |
|
|
| T |
14409084 |
a--tggtgggaccccttcccgaaccctacgtatg |
14409053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 15 - 88
Target Start/End: Original strand, 18327012 - 18327085
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggta |
88 |
Q |
| |
|
|||||||| || ||||||||| || | ||||||| ||||||| ||||| | ||||||||||||||||||||| |
|
|
| T |
18327012 |
taaagttgttgtcatgtgacttgaaggtcacgggttcaagtcccggaaacagcctcttgtgtaaaaacagggta |
18327085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 15 - 88
Target Start/End: Complemental strand, 44123778 - 44123705
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggta |
88 |
Q |
| |
|
||||||||||| ||||||||||||| |||||| ||||| || ||||| | |||||||||||||||| |||| |
|
|
| T |
44123778 |
taaagttggtgtcatgtgactgaaagattacgggttcaagtactggaaacagcctcttgtgtaaaaacaaggta |
44123705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 79
Target Start/End: Original strand, 7193063 - 7193127
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaa |
79 |
Q |
| |
|
|||||||| || ||||||||||||| | ||||||| |||||||| ||||| |||||||||||| |
|
|
| T |
7193063 |
taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctcgaaacaacctcttgtgtaaa |
7193127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 130 - 178
Target Start/End: Original strand, 36602535 - 36602583
Alignment:
| Q |
130 |
tcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||| ||||||||||||| ||||||||| |||||||| | ||||||||| |
|
|
| T |
36602535 |
tcccagaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
36602583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 94; Significance: 5e-46; HSPs: 55)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 12 - 177
Target Start/End: Original strand, 10543673 - 10543835
Alignment:
| Q |
12 |
tgataaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacac |
110 |
Q |
| |
|
||||||||||| || ||||||||||||| | ||||||| |||||||| ||||||| |||||||||||||| ||||||| |||||||||| ||||||| |
|
|
| T |
10543673 |
tgataaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacggcctcttgtgtaaaaaacagggta----aggctgcgtacaatacac |
10543768 |
T |
 |
| Q |
111 |
caaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| |||||||| | |||||||| |
|
|
| T |
10543769 |
caaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
10543835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 15 - 178
Target Start/End: Complemental strand, 24200782 - 24200622
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || ||||||||||||| | ||||||| |||||||| ||||| | |||||||||||||| ||||||| |||||||||| |||||||||| |
|
|
| T |
24200782 |
taaagttgttgtcatgtgactgaaaagtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta----aggctgcgtacaatacaccaa |
24200687 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||| | ||||||| |||||||| | ||||||||| |
|
|
| T |
24200686 |
aaatggtgggaacccttcccggaccctgagtatgtgagagctttagtgcaccgggttgccctttt |
24200622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 15 - 177
Target Start/End: Original strand, 14530296 - 14530455
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || ||||||||||||| | ||||||| |||||||| ||||| | ||||||| |||||| ||||||| ||||| |||| |||||||||| |
|
|
| T |
14530296 |
taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggta----aggctacgtacaatacaccaa |
14530391 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |||||||| | |||||||| |
|
|
| T |
14530392 |
taatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
14530455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 10 - 181
Target Start/End: Original strand, 5841001 - 5841169
Alignment:
| Q |
10 |
aatgataaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtaggg-aaggctgcgtaaaatac |
108 |
Q |
| |
|
||||||||||||| || |||||||||| || | ||||||| |||||||||||||| | || ||||||||||| ||||| |||| |||||| ||||| |
|
|
| T |
5841001 |
aatgataaagttgttgtcatgtgactggaaggtcacgggttcaagtcctagaaacagccttttgtgtaaaaaa----tagggtaaggatgcgtacaatac |
5841096 |
T |
 |
| Q |
109 |
accaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttttagg |
181 |
Q |
| |
|
| ||| ||||||||||||||||||||||||| || |||| ||||||||| |||||||||| |||||||||||| |
|
|
| T |
5841097 |
atcaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgcccttttagg |
5841169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 15 - 179
Target Start/End: Complemental strand, 8455473 - 8455314
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaa-acagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || |||||||||| || | ||||||| |||||||| ||||| | ||||||||||||| |||||||| |||||||||| |||||||||| |
|
|
| T |
8455473 |
taaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacacagggta----aggctgcgtacaatacaccaa |
8455378 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
| ||||||||||||||||||||||||||||||| |||||||| |||||||| | |||||||||| |
|
|
| T |
8455377 |
a--tggtgggaccccttcccggaccctgcgtatgccggagctttagtgcaccgggttgccctttta |
8455314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 15 - 180
Target Start/End: Original strand, 9671158 - 9671317
Alignment:
| Q |
15 |
taaagttggtggcatgtgactg-aaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || |||||||||| ||| | ||||||| ||| |||| ||||| | ||||||||||||| ||||||| |||||||||| |||||||||| |
|
|
| T |
9671158 |
taaagttgttgtcatgtgactggaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaa-cagggta----aggctgcgtacaatacaccaa |
9671252 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttttag |
180 |
Q |
| |
|
| ||||||||||||||||||||||||||||||| ||||||||| |||||||| | ||||||||||| |
|
|
| T |
9671253 |
a--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttag |
9671317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 15 - 146
Target Start/End: Complemental strand, 12024075 - 12023950
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||||||||||| | ||||||| |||||||| ||||| | |||||||||||||||||||| ||||||||||| |||||||| | |
|
|
| T |
12024075 |
taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggt----aaggctgcgtacaatacacc--a |
12023982 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtat |
146 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |
|
|
| T |
12023981 |
aatggtgggaccccctcccggaccctgcgtat |
12023950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 15 - 178
Target Start/End: Complemental strand, 25249894 - 25249737
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || |||||||||| || | ||||||| |||||| | ||||| |||||||||||| |||||||||| |||||||||| ||||||||||| |
|
|
| T |
25249894 |
taaagttgttgtcatgtgactgtaaggtcacgggttcaagtcatggaaacagtctcttgtgtacaaacagggta----aggctgcgtacaatacaccaaa |
25249799 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||| ||||||||| |||||||||||| | ||||||| |||||||| | ||||||||| |
|
|
| T |
25249798 |
--tggtgggatcccttcccgaaccctgcgtatgcgtgagctttagtgcaccgggttgccctttt |
25249737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 28 - 178
Target Start/End: Original strand, 14444720 - 14444864
Alignment:
| Q |
28 |
atgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccc |
127 |
Q |
| |
|
||||||||| || | ||||||| |||||||| ||||| | ||||||||||||||||||||| |||||| ||| |||||||||| ||||||||||| |
|
|
| T |
14444720 |
atgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggta----aggctgtgtacgatacaccaaa--tggtgggaccc |
14444813 |
T |
 |
| Q |
128 |
cttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||| | ||||||||| |
|
|
| T |
14444814 |
cttcccggaccctgcgtatgcgggagctttagtgcaccaggttgccctttt |
14444864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 28 - 178
Target Start/End: Original strand, 10546153 - 10546299
Alignment:
| Q |
28 |
atgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa--cagggtagggaaggctgcgtaaaatacaccaaaaatggtgggac |
125 |
Q |
| |
|
|||||||||||| | ||||||| |||||||| ||||| ||||||| |||||| ||||||| |||||||||| ||||||||||| ||||||||| |
|
|
| T |
10546153 |
atgtgactgaaaggtcacgggttcaagtcctggaaacatcctcttgtataaaaaaacagggta----aggctgcgtacaatacaccaaa--tggtgggac |
10546246 |
T |
 |
| Q |
126 |
cccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||| | ||||||||| |
|
|
| T |
10546247 |
cccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
10546299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 15 - 178
Target Start/End: Original strand, 17896237 - 17896396
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtaggg-aaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || |||||||| |||| | ||||| | |||||||||||||| |||||||||||||| | ||||| ||||||||||| |||| ||||| |
|
|
| T |
17896237 |
taaagttgttgtcatgtgaccgaaaggtcacggattcaagtcctagaaacaacctcttgtgtaaaaaaa---tagggtaaggctgcgtacaatataccaa |
17896333 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
| ||||||||||||||| ||||||||||||||| ||||||||| ||||| |||| ||||||||| |
|
|
| T |
17896334 |
a--tggtgggaccccttctcggaccctgcgtatgtgggagctttagtgcatcgagttgccctttt |
17896396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 17 - 179
Target Start/End: Complemental strand, 21779414 - 21779259
Alignment:
| Q |
17 |
aagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaa |
116 |
Q |
| |
|
|||||| || ||||||||||||| | ||||||| |||||||| || || | ||||||||||||| ||||||| ||| |||||| ||||||||||| |
|
|
| T |
21779414 |
aagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggagacagcctcttgtgtaaaa-cagggta----aggttgcgtacaatacaccaaa-- |
21779322 |
T |
 |
| Q |
117 |
tggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||| | |||||||| | |||||||||| |
|
|
| T |
21779321 |
tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttta |
21779259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 15 - 178
Target Start/End: Complemental strand, 21377230 - 21377073
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || ||||||||||||| | ||| || |||||| ||||||| |||||||||||||| ||||||| |||||| ||| ||| |||||| |
|
|
| T |
21377230 |
taaagttgttgtcatgtgactgaaaggttacgagttcaagtcatagaaacatcctcttgtgtaaaaaacagggta----aggctgggtacaatgcaccaa |
21377135 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
| |||||||||||||||||| |||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
21377134 |
a--tggtgggaccccttcccgaaccctgcgtatgtgggagcttt-gtgcaccgagctgccctttt |
21377073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 53 - 178
Target Start/End: Original strand, 36871509 - 36871627
Alignment:
| Q |
53 |
agtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgaggga |
152 |
Q |
| |
|
|||||| ||||| | ||||||||| ||||||||||| |||||||||| ||||||||||| |||||||||||||||||||| |||||||||| |||| |
|
|
| T |
36871509 |
agtcctggaaacagcctcttgtgtgaaaacagggta----aggctgcgtacaatacaccaaa--tggtgggaccccttcccgga-cctgcgtatgcggga |
36871601 |
T |
 |
| Q |
153 |
gctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||| |||||||| | ||||||||| |
|
|
| T |
36871602 |
gctttagtgcaccgggttgccctttt |
36871627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 15 - 165
Target Start/End: Original strand, 7214512 - 7214659
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaa-acagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || ||||||||||||| | || |||| |||||| | ||||| ||||||||||||||| |||||||| |||||||||| ||||||| || |
|
|
| T |
7214512 |
taaagttgttgtcatgtgactgaaaggtcatgggttcaagtcttggaaacagtctcttgtgtaaaatacagggta----aggctgcgtacaatacacaaa |
7214607 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcacc |
165 |
Q |
| |
|
|||||||| || |||||| ||||| ||||||||| | ||| ||| ||||||| |
|
|
| T |
7214608 |
aaatggtgagatcccttctcggacactgcgtatgcgagagttttagtgcacc |
7214659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 15 - 178
Target Start/End: Original strand, 17667980 - 17668138
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || |||||||||| || | ||||||| |||||||| |||| |||||||||||||| ||||||| |||||||||| |||||||||| |
|
|
| T |
17667980 |
taaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaagaacctcttgtgtaaaaatcagggta----aggctgcgtacaatacaccaa |
17668075 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
| |||||| |||||||| || ||||||||||| ||||||||| |||||||| | ||||||||| |
|
|
| T |
17668076 |
a--tggtggaaccccttctcgaaccctgcgtatatgggagctttagtgcaccgggttgccctttt |
17668138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 15 - 177
Target Start/End: Complemental strand, 25079875 - 25079717
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || |||||||||| || | ||||||| |||||| ||||||| |||||||||||||| | ||| |||| |||||| |||||||| || |
|
|
| T |
25079875 |
taaagttgttgtcatgtgactggaaggtcacgggttcaagtcttagaaacaacctcttgtgtaaaaaaaca--aggtaaggatgcgtacaatacaccgaa |
25079778 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |||||||| | |||||||| |
|
|
| T |
25079777 |
--tggtgggaccccttcccggaccctgcgtatgcaagagctttagtgcaccgggttgcccttt |
25079717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 104 - 179
Target Start/End: Original strand, 23488545 - 23488620
Alignment:
| Q |
104 |
aatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| | ||||||| |||||||| | ||| |||||| |
|
|
| T |
23488545 |
aatacacaaaaaatggtgggaccccttcccggaccctgcgtatgcgagagctttagtgcaccgggttgctctttta |
23488620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 15 - 177
Target Start/End: Original strand, 23397744 - 23397899
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||||||||||| | || |||| |||||||| ||||| | ||||||||||||| |||||| ||||| |||| ||||||||||| |
|
|
| T |
23397744 |
taaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaaat-agggta----aggctacgtacaatacaccaaa |
23397838 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
||||||||||||||| |||||||| | |||| ||||||| | |||||||| | |||||||| |
|
|
| T |
23397839 |
--tggtgggaccccttctcggaccctacatatgcgggagctctagtgcaccgggttgcccttt |
23397899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 15 - 179
Target Start/End: Original strand, 11514414 - 11514572
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || |||||||||| || | ||||||| ||| |||| ||||| | |||||||||||||| || ||| |||||||||| |||||||||| |
|
|
| T |
11514414 |
taaagttgttgtcatgtgactggaaggtcacgggttcaactcctggaaacagcctcttgtgtaaaaaacaaagta----aggctgcgtacaatacaccaa |
11514509 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
| ||||||||||| ||||| ||||||||||||| ||||||||| |||||||| |||||||||| |
|
|
| T |
11514510 |
a--tggtgggaccc-ttcccagaccctgcgtatgcgggagctttagtgcaccggattgccctttta |
11514572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 114 - 179
Target Start/End: Original strand, 44643595 - 44643660
Alignment:
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||| || |||||||| |||||||||||| |
|
|
| T |
44643595 |
aaatggtgggaccccttcccagaccctgcgtatgcgggagccttagtgcaccgggctgccctttta |
44643660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 15 - 177
Target Start/End: Original strand, 14544041 - 14544201
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgta--aaaacagggtagggaaggctgcgtaaaatacacca |
112 |
Q |
| |
|
|||||||| || ||||||||||||| | || |||||| || || ||||| | |||||||||| ||||||||||| || |||||| |||| | | |
|
|
| T |
14544041 |
taaagttgttgtcatgtgactgaaaggttacaggtccaggtactggaaacagcctcttgtgtagaaaaacagggta----agactgcgtgcaataaccaa |
14544136 |
T |
 |
| Q |
113 |
aaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||| ||||||||| ||||||| || |||||||| |
|
|
| T |
14544137 |
aaaatggtcggaccccttccgggaccctgcgtatgcgggagctttagtgcaccaagttgcccttt |
14544201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 15 - 178
Target Start/End: Original strand, 17623542 - 17623700
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || |||| ||||| || | ||||||| |||||||| ||||| |||||||||||||| ||||||| |||||||||| |||||||||| |
|
|
| T |
17623542 |
taaagttgttgtcatgcgactggaaggtcacgggttcaagtcctcgaaacaacctcttgtgtaaaaatcagggta----aggctgcgtacaatacaccaa |
17623637 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
| |||||| ||||||||||| | |||||||||| || |||||| |||||| | | ||||||||| |
|
|
| T |
17623638 |
a--tggtggaaccccttcccgaatcctgcgtatgtggaagctttagtgcactgggttgccctttt |
17623700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 15 - 146
Target Start/End: Original strand, 22371035 - 22371158
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || |||||||||| | | ||||||| |||||||| ||||| | ||| |||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
22371035 |
taaagttgttgtcatgtgactgggaggtcacgggttcaagtcctggaaacagcctc--gtgtaaaaacagggta----aggctgcgtacaatacaccaaa |
22371128 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtat |
146 |
Q |
| |
|
||||||||||||||||||||||||| |||| |
|
|
| T |
22371129 |
--tggtgggaccccttcccggaccctgtgtat |
22371158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 92 - 177
Target Start/End: Complemental strand, 40762317 - 40762234
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
|||||| |||| ||||||||||| ||||||||||| |||| |||||||||||||| ||||||||| |||||||| | |||||||| |
|
|
| T |
40762317 |
aaggctacgtacaatacaccaaa--tggtgggaccctttcctggaccctgcgtatgtgggagctttagtgcaccgggttgcccttt |
40762234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 104 - 157
Target Start/End: Complemental strand, 31158512 - 31158459
Alignment:
| Q |
104 |
aatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagcttt |
157 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
31158512 |
aataaaccaaaaatggtgggaccccttcccagaccctgcgtatgcgggagcttt |
31158459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 95 - 174
Target Start/End: Complemental strand, 4516431 - 4516354
Alignment:
| Q |
95 |
gctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccc |
174 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||||||||||| || |||||| ||| |||| ||||||| |
|
|
| T |
4516431 |
gctgcgtacaatacaccaat--tggtgggaccccttcccggaccctgcgtatgtggaagctttagtgtaccgggctgccc |
4516354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 116 - 176
Target Start/End: Complemental strand, 40579810 - 40579750
Alignment:
| Q |
116 |
atggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctt |
176 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||||||| |||||||| | ||||||| |
|
|
| T |
40579810 |
atggtgggaccccttcccggaccctgagtatgcgggagctttagtgcaccgggttgccctt |
40579750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 15 - 157
Target Start/End: Complemental strand, 99420 - 99285
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || || |||||||||| | ||||||| |||||||||||||| | ||||||| ||||||| || | |||||||||| |||||||| | |
|
|
| T |
99420 |
taaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctagaaacagcctcttgta-aaaaacatggca----aggctgcgtacaatacacc--a |
99328 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagcttt |
157 |
Q |
| |
|
|||||||| |||||||| | ||||||| ||||| ||||||||| |
|
|
| T |
99327 |
aatggtggaaccccttctcagaccctgtgtatgcgggagcttt |
99285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 92 - 178
Target Start/End: Complemental strand, 15296490 - 15296405
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||||| |||| ||||||| | |||||| |||||| ||||||||||||||| || ||||||||||| || ||||||||||| |
|
|
| T |
15296490 |
aaggctgcgtacaatataccaaaa-tagtgggatcccttctcggaccctgcgtatgtggaagctttggtgcgccaggctgccctttt |
15296405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 27 - 165
Target Start/End: Original strand, 19614982 - 19615116
Alignment:
| Q |
27 |
catgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaaaatggtgggac |
125 |
Q |
| |
|
||||||||||||| | ||||||| |||||||| ||||| ||||||| |||||| ||||||| || ||||||| |||| ||||| ||| |||| || |
|
|
| T |
19614982 |
catgtgactgaaaggtcacgggttcaagtccttgaaacatcctcttgtataaaaaacagggta----agactgcgtacaatataccaataatagtgg-ac |
19615076 |
T |
 |
| Q |
126 |
cccttcccggaccctgcgtatgagggagctttggtgcacc |
165 |
Q |
| |
|
||||||||| |||||||||||| |||||||| ||||||| |
|
|
| T |
19615077 |
cccttcccgaaccctgcgtatgcaggagctttagtgcacc |
19615116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 93 - 166
Target Start/End: Complemental strand, 24860070 - 24859999
Alignment:
| Q |
93 |
aggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
|||||||||| ||||||||||| |||| | |||||||| ||||||||||||||| ||||||||| |||||||| |
|
|
| T |
24860070 |
aggctgcgtacaatacaccaaa--tggtagaaccccttctcggaccctgcgtatgcgggagctttagtgcaccg |
24859999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 117 - 179
Target Start/End: Original strand, 34080176 - 34080238
Alignment:
| Q |
117 |
tggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||| ||| |||||||| | |||||||||| |
|
|
| T |
34080176 |
tggtgggaccccttcccggaccctgcatatgcgggagttttagtgcaccgggttgccctttta |
34080238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 117 - 163
Target Start/End: Original strand, 34766330 - 34766376
Alignment:
| Q |
117 |
tggtgggaccccttcccggaccctgcgtatgagggagctttggtgca |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
34766330 |
tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgca |
34766376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 92 - 164
Target Start/End: Original strand, 24890463 - 24890533
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcac |
164 |
Q |
| |
|
|||||||| || |||||||||| ||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
24890463 |
aaggctgcatacaatacaccaat--tggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcac |
24890533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 92 - 153
Target Start/End: Complemental strand, 44449467 - 44449407
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggag |
153 |
Q |
| |
|
||||||||||| |||||||||||| | |||||||||||||||||||||||||| || ||||| |
|
|
| T |
44449467 |
aaggctgcgtacaatacaccaaaa-tagtgggaccccttcccggaccctgcgtttgtgggag |
44449407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 97 - 157
Target Start/End: Complemental strand, 19185823 - 19185763
Alignment:
| Q |
97 |
tgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagcttt |
157 |
Q |
| |
|
|||||| ||| ||| ||||||||||| ||||||||| |||||||||||||| ||||||||| |
|
|
| T |
19185823 |
tgcgtacaatgcacaaaaaatggtggaaccccttcctggaccctgcgtatgcgggagcttt |
19185763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 122 - 165
Target Start/End: Original strand, 8575975 - 8576018
Alignment:
| Q |
122 |
ggaccccttcccggaccctgcgtatgagggagctttggtgcacc |
165 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
8575975 |
ggaccccttcccggaccctgcgtatgtgggagctttagtgcacc |
8576018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 96 - 158
Target Start/End: Complemental strand, 32781367 - 32781307
Alignment:
| Q |
96 |
ctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttg |
158 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||| ||||||| ||||| |||||||||| |
|
|
| T |
32781367 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccagaccctgtgtatgcgggagctttg |
32781307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 116 - 175
Target Start/End: Original strand, 41409936 - 41409995
Alignment:
| Q |
116 |
atggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccct |
175 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||||| |||||||| | |||||| |
|
|
| T |
41409936 |
atggtgggaccccttcccggaccctgcatatgcgggagcttcagtgcaccgggttgccct |
41409995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 123 - 177
Target Start/End: Complemental strand, 3633762 - 3633708
Alignment:
| Q |
123 |
gaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
||||||||||||||||| || |||| ||||||||| |||||||||| |||||||| |
|
|
| T |
3633762 |
gaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgcccttt |
3633708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 129 - 179
Target Start/End: Original strand, 22371199 - 22371249
Alignment:
| Q |
129 |
ttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||| | |||||||||| |
|
|
| T |
22371199 |
ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttta |
22371249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 92 - 177
Target Start/End: Original strand, 25632561 - 25632644
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
||||||||||| ||||||||||| |||||||| |||||||| ||| | |||||| ||||||||| |||||||| | |||||||| |
|
|
| T |
25632561 |
aaggctgcgtacaatacaccaaa--tggtgggattccttcccgaaccttacgtatgcgggagctttagtgcaccgggttgcccttt |
25632644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 116 - 157
Target Start/End: Complemental strand, 24059057 - 24059016
Alignment:
| Q |
116 |
atggtgggaccccttcccggaccctgcgtatgagggagcttt |
157 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
24059057 |
atggtgggacccctttccggaccctgcgtatgtgggagcttt |
24059016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 31 - 115
Target Start/End: Complemental strand, 29420030 - 29419945
Alignment:
| Q |
31 |
tgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaaa |
115 |
Q |
| |
|
||||||||| | |||| || |||||||| ||||| |||||||||||||| ||||||| | ||||||||||| |||||||||||| |
|
|
| T |
29420030 |
tgactgaaaggtcacgagttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaagtaaggctgcgtacaatacaccaaaa |
29419945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 15 - 140
Target Start/End: Original strand, 5450263 - 5450384
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa--cagggtagggaaggctgcgtaaaatacacca |
112 |
Q |
| |
|
|||||||| || ||||||||||||| | ||||||| ||| |||| ||||| |||||||||||||| || |||| |||||||||| |||||||| |
|
|
| T |
5450263 |
taaagttgttgtcatgtgactgaaaggtcacgggttcaattcctggaaacaacctcttgtgtaaaaaaacatggta----aggctgcgtacaatacacc- |
5450357 |
T |
 |
| Q |
113 |
aaaatggtgggaccccttcccggaccct |
140 |
Q |
| |
|
||| ||||||||||||||| ||||||| |
|
|
| T |
5450358 |
-aaagggtgggaccccttcctggaccct |
5450384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 114 - 166
Target Start/End: Complemental strand, 26684683 - 26684631
Alignment:
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||| ||||||||| ||||||| |
|
|
| T |
26684683 |
aaatggtgggacctcttcccgaaccctgcgtatgcgggagctttaatgcaccg |
26684631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 115 - 179
Target Start/End: Complemental strand, 39914367 - 39914304
Alignment:
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
|||||||||||||||||| | |||||||||||| ||||||||| ||||| || | |||||||||| |
|
|
| T |
39914367 |
aatggtgggaccccttcctg-accctgcgtatgcgggagctttagtgcatcgggttgccctttta |
39914304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 15 - 178
Target Start/End: Original strand, 27573599 - 27573756
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||||||||||| | || ||| ||||||| | ||| | |||||||||| ||||| |||| |||||||||| |||||||| | |
|
|
| T |
27573599 |
taaagttgttgtcatgtgactgaaaggtcattggttcaagtccgggcaacagcctcttgtgtataaacatggta----aggctgcgtacaatacacc--a |
27573692 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||| ||| ||||| |||||| ||||| ||||||||| ||||| || | ||||||||| |
|
|
| T |
27573693 |
aatggtggaaccatttcccaaaccctgtgtatgtgggagctttagtgcatcgggttgccctttt |
27573756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 92 - 165
Target Start/End: Complemental strand, 19977797 - 19977726
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcacc |
165 |
Q |
| |
|
|||| |||||| ||||||||||| |||||||| ||||||||| ||| || ||||| ||||||||| ||||||| |
|
|
| T |
19977797 |
aaggttgcgtacaatacaccaaa--tggtgggatcccttcccgaaccttgtgtatgcgggagctttagtgcacc |
19977726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 116 - 158
Target Start/End: Original strand, 33795359 - 33795401
Alignment:
| Q |
116 |
atggtgggaccccttcccggaccctgcgtatgagggagctttg |
158 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||| |||||||||| |
|
|
| T |
33795359 |
atggtgggaccccttcccagaccctgtgtatgcgggagctttg |
33795401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 129 - 166
Target Start/End: Complemental strand, 124962 - 124925
Alignment:
| Q |
129 |
ttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
124962 |
ttcccggaccctgcgtatgcgggagctttagtgcaccg |
124925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 15 - 88
Target Start/End: Original strand, 44604832 - 44604905
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggta |
88 |
Q |
| |
|
|||||||| || |||||||||| || | ||| ||| |||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
44604832 |
taaagttgttgtcatgtgactggaaggtcacaggttcaagtcctggaaacaacctcttgtgtaaaaacagggta |
44604905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 130 - 178
Target Start/End: Original strand, 760066 - 760114
Alignment:
| Q |
130 |
tcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||| |||| |||||| |
|
|
| T |
760066 |
tcccgaaccctgcgtatgtgggagctttggtgcaccaggctgtcctttt |
760114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 130 - 178
Target Start/End: Complemental strand, 23053012 - 23052964
Alignment:
| Q |
130 |
tcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||| ||||||||||||| |||||||| |||||||| ||||||||||| |
|
|
| T |
23053012 |
tcccagaccctgcgtatgcaggagcttttgtgcaccgggctgccctttt |
23052964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 84; Significance: 5e-40; HSPs: 58)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 16 - 179
Target Start/End: Complemental strand, 13628948 - 13628788
Alignment:
| Q |
16 |
aaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaa-aaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
||||||| || ||||||||||||| | ||||||| |||||||| ||||| | ||||||||||| |||||||||| |||||||||| |||||||||| |
|
|
| T |
13628948 |
aaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaagaaacagggta----aggctgcgtacaatacaccaat |
13628853 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |||||||| | |||||||||| |
|
|
| T |
13628852 |
aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttta |
13628788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 15 - 180
Target Start/End: Complemental strand, 29366879 - 29366717
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || ||||||||| ||| | ||||||| |||||||| ||||| | ||||||| |||||| ||||||| |||||||||| |||||||||| |
|
|
| T |
29366879 |
taaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggta----aggctgcgtacaatacaccaa |
29366784 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttttag |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |||||| | | ||||||||||| |
|
|
| T |
29366783 |
taatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcactgggttgcccttttag |
29366717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 15 - 178
Target Start/End: Original strand, 26869707 - 26869864
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||||||||||| | ||| ||| |||||||| ||||| | |||| |||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
26869707 |
taaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctctggtgtaaaaacagggta----aggctgcgtacaatacaccaaa |
26869802 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||||||||| ||||||| |||||||| |||||||||||||||||| | ||||||||| |
|
|
| T |
26869803 |
--tggtgggaccccttgccggaccatgcgtatgcgggagctttggtgcaccgggttgccctttt |
26869864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 15 - 157
Target Start/End: Complemental strand, 46421194 - 46421055
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || ||||||||| ||| | ||||||| |||||||| ||||| | |||||||||||||| ||||||| |||||||||| |||||||||| |
|
|
| T |
46421194 |
taaagttgttgtcatgtgacttaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta----aggctgcgtacaatacaccaa |
46421099 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagcttt |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
46421098 |
taatggtgggaccccttcccggaccctgcgtatgcgggagcttt |
46421055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 15 - 178
Target Start/End: Complemental strand, 13730761 - 13730601
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || |||||||||| || | ||||||| |||||||| ||||| | |||||||||||||| ||||||| |||||| ||| |||||||||| |
|
|
| T |
13730761 |
taaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta----aggctgtgtacaatacaccaa |
13730666 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||||||||||||||||||| || |||| ||||||||| |||||||| | ||||||||| |
|
|
| T |
13730665 |
taatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
13730601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 15 - 157
Target Start/End: Complemental strand, 8247846 - 8247707
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || ||||||||||||| | ||||||| |||||||| ||||| | |||||||||||||| ||||||| ||| |||||| |||||||||| |
|
|
| T |
8247846 |
taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta----aggttgcgtacaatacaccaa |
8247751 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagcttt |
157 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
8247750 |
taatggtgggactccttcccggaccctgcgtatgcgggagcttt |
8247707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 15 - 178
Target Start/End: Complemental strand, 40272969 - 40272811
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || |||||||||| || | || |||| |||||||| ||||| |||||||||||||| ||||||| |||||||||| |||||||||| |
|
|
| T |
40272969 |
taaagttgttgtcatgtgactggaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggta----aggctgcgtacaatacaccaa |
40272874 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
| ||||||||||||||||||||||||||||||| ||||||||| |||||||| | ||||||||| |
|
|
| T |
40272873 |
a--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
40272811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 15 - 178
Target Start/End: Complemental strand, 34420801 - 34420642
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || || |||||||||| | ||||||| |||||||| ||||| | |||||||||||||| ||||||| |||||||||| ||||||||| |
|
|
| T |
34420801 |
taaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta----aggctgcgtaccatacaccaa |
34420706 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|| |||||||||||||||||||||| |||||||| ||||||||| |||||| ||||||||||| |
|
|
| T |
34420705 |
aa-tggtgggaccccttcccggaccttgcgtatgtgggagctttagtgcacatggctgccctttt |
34420642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 43 - 165
Target Start/End: Complemental strand, 10795554 - 10795435
Alignment:
| Q |
43 |
cacgggtccaagtcctagaaacggtctcttgtgtaaaa-acagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctg |
141 |
Q |
| |
|
||||||| |||||||| ||||| | ||||||||||||| |||||||| |||||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10795554 |
cacgggttcaagtcctggaaacagcctcttgtgtaaaagacagggta----aggctgcgtacaatacaccaaaaatggtgggaccccttcctggaccctg |
10795459 |
T |
 |
| Q |
142 |
cgtatgagggagctttggtgcacc |
165 |
Q |
| |
|
|||||| |||||||| ||||||| |
|
|
| T |
10795458 |
cgtatgcgggagcttcagtgcacc |
10795435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 16 - 178
Target Start/End: Complemental strand, 5173876 - 5173718
Alignment:
| Q |
16 |
aaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaa |
115 |
Q |
| |
|
||||||| || ||||||||||||| | ||||||| |||||||| ||||| |||||||||||||||| ||| ||| ||| | |||||||||||| |
|
|
| T |
5173876 |
aaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaacaaagta----aggttgcatgcaatacaccaaaa |
5173781 |
T |
 |
| Q |
116 |
atggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||| |||||||||||||| |||||||| ||||||||| |||||||| | ||||||||| |
|
|
| T |
5173780 |
atggtggggccccttcccggaccttgcgtatgcgggagctttagtgcaccgggttgccctttt |
5173718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 15 - 176
Target Start/End: Original strand, 22609766 - 22609921
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || |||||||||| || | |||||| |||||| | ||||| | ||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
22609766 |
taaagttgttgtcatgtgactgtaaggtaacgggttcaagtcttggaaacagcctcttgtgtaaaaacagggta----aggctgcgtacaatacaccaaa |
22609861 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctt |
176 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||||| |||||||| | ||||||| |
|
|
| T |
22609862 |
--tggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttgccctt |
22609921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 27 - 178
Target Start/End: Original strand, 516421 - 516570
Alignment:
| Q |
27 |
catgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaaaa-tggtggga |
124 |
Q |
| |
|
||||||||||||| | ||||||| |||||||| ||||| | |||||||||||||| ||||||| |||||||| | |||| |||||||| ||| |||| |
|
|
| T |
516421 |
catgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta----aggctgcgcacaataaaccaaaaaatggcggga |
516516 |
T |
 |
| Q |
125 |
ccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||| |||||||| | ||||||||| |
|
|
| T |
516517 |
ccccttccccgaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
516570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 15 - 179
Target Start/End: Original strand, 16735441 - 16735599
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || |||||||||| |||| ||||||| |||||||| ||||| | ||||||| ||||||||||| ||||||||||| |||||||| | |
|
|
| T |
16735441 |
taaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggt----aaggctgcgtacaatacacc--a |
16735534 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| || ||||| |||||| | | |||||||||| |
|
|
| T |
16735535 |
aatggtgggaccccttcccggacactgcgtatgcggtagcttcagtgcactgggttgccctttta |
16735599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 15 - 177
Target Start/End: Original strand, 39203516 - 39203671
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||||||||||| | ||| ||| |||||||| ||||| | ||||||||||||| ||||||| ||| |||||| ||||||||||| |
|
|
| T |
39203516 |
taaagttgttgtcatgtgactgaaaggtcacaggttcaagtccttgaaacagcctcttgtgtaaaa-cagggta----aggttgcgtacaatacaccaaa |
39203610 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
|||||||||||||||||||||| ||| |||| ||||||||| |||||||| | |||||||| |
|
|
| T |
39203611 |
--tggtgggaccccttcccggaccttgcatatgcgggagctttagtgcaccgggttgcccttt |
39203671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 27 - 176
Target Start/End: Complemental strand, 22123060 - 22122918
Alignment:
| Q |
27 |
catgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggacc |
126 |
Q |
| |
|
||||||||||||| | | ||||| |||||||| ||||| ||||||||||||||| ||||||| |||||||||| ||||||||||| |||||||||| |
|
|
| T |
22123060 |
catgtgactgaaaggtcgcgggttcaagtcctggaaacagtctcttgtgtaaaa-cagggta----aggctgcgtacaatacaccaaa--tggtgggacc |
22122968 |
T |
 |
| Q |
127 |
ccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctt |
176 |
Q |
| |
|
|||||||||||||||| |||| | ||||| | |||||||| | ||||||| |
|
|
| T |
22122967 |
ccttcccggaccctgcatatgcgagagctctagtgcaccgggttgccctt |
22122918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 92 - 177
Target Start/End: Complemental strand, 45786299 - 45786214
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||| ||| |||||||| |||||||| | |||||||| |
|
|
| T |
45786299 |
aaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgaatgctggagctttagtgcaccgggttgcccttt |
45786214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 27 - 178
Target Start/End: Original strand, 1217102 - 1217246
Alignment:
| Q |
27 |
catgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggacc |
126 |
Q |
| |
|
||||| ||||||| | ||||||| |||||||| ||||| | ||||||||||||| ||||||| |||||||||| ||||||||||| ||| |||||| |
|
|
| T |
1217102 |
catgtcactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa-cagggta----aggctgcgtacaatacaccaaa--tggcgggacc |
1217194 |
T |
 |
| Q |
127 |
ccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||||||||||| |||| ||||||| | |||||||| | ||||||||| |
|
|
| T |
1217195 |
ccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
1217246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 92 - 178
Target Start/End: Original strand, 54484765 - 54484849
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |||||||| | ||||||||| |
|
|
| T |
54484765 |
aaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
54484849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 15 - 175
Target Start/End: Original strand, 26573127 - 26573282
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || || |||||||||| | ||||||| |||||||| ||||| | ||| |||||||||| ||||||| |||||||||| |||||||||| |
|
|
| T |
26573127 |
taaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacagcctcctgtgtaaaaaacagggta----aggctgcgtacaatacaccaa |
26573222 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccct |
175 |
Q |
| |
|
|||||||||||| |||||||||||||||||| | ||||||| ||||||| |||||||| |
|
|
| T |
26573223 |
t--tggtgggaccccatcccggaccctgcgtatgcgtgagctttagtgcaccaggctgccct |
26573282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 92 - 175
Target Start/End: Complemental strand, 353434 - 353351
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccct |
175 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||||||| || |||| ||||||||| |||||||| | |||||| |
|
|
| T |
353434 |
aaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccct |
353351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 51 - 166
Target Start/End: Original strand, 14986993 - 14987105
Alignment:
| Q |
51 |
caagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgag |
149 |
Q |
| |
|
|||||||| ||||| | |||||||||||||| ||||||| |||||||||| |||||||||| ||||||||||||| |||||||||| ||| |||| | |
|
|
| T |
14986993 |
caagtcctggaaacagcctcttgtgtaaaaaacagggta----aggctgcgtacaatacaccaataatggtgggacccattcccggaccttgcatatgcg |
14987088 |
T |
 |
| Q |
150 |
ggagctttggtgcaccg |
166 |
Q |
| |
|
|||||||| |||||||| |
|
|
| T |
14987089 |
ggagctttagtgcaccg |
14987105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 92 - 178
Target Start/End: Complemental strand, 34771447 - 34771363
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||||||||||| |||| ||||||| | |||||||| ||||||||||| |
|
|
| T |
34771447 |
aaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggctgccctttt |
34771363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 31 - 178
Target Start/End: Complemental strand, 53996707 - 53996564
Alignment:
| Q |
31 |
tgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaaaatggtgggacccct |
129 |
Q |
| |
|
||||||||| | |||| || |||||| | ||||| |||||||||||||| ||||||| ||||||| || |||||||||||| ||||||||||||| |
|
|
| T |
53996707 |
tgactgaaaggtcacgtgttcaagtcgtggaaacaacctcttgtgtaaaaaacagggta----aggctgcttacaatacaccaaaa-tggtgggacccct |
53996613 |
T |
 |
| Q |
130 |
tcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||| ||| ||||||||| ||||||||| |||||||| ||||||||||| |
|
|
| T |
53996612 |
tccctgacactgcgtatgtgggagctttagtgcaccgggctgccctttt |
53996564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 92 - 178
Target Start/End: Complemental strand, 49013558 - 49013472
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||||||| || || | ||||||||| |||||||| | ||||||||| |
|
|
| T |
49013558 |
aaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatacgcgggagctttagtgcaccgggttgccctttt |
49013472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 15 - 178
Target Start/End: Original strand, 25944469 - 25944628
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || || |||||||||| | || |||| |||||||| ||||| | |||| ||||||||| || | ||||||| ||| ||||||||||| |
|
|
| T |
25944469 |
taaagttgttgtcacgtgactgaaaggtcatgggttcaagtcctggaaaccgcctctcgtgtaaaaaactgg---gcaaggctgagtacaatacaccaaa |
25944565 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
| ||||||||||||||||| ||||||||||||| ||||||||| | ||||| ||||||||||| |
|
|
| T |
25944566 |
a-tggtgggaccccttccctgaccctgcgtatgtgggagctttagcgcaccaggctgccctttt |
25944628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 44 - 177
Target Start/End: Original strand, 31592878 - 31593004
Alignment:
| Q |
44 |
acgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcg |
143 |
Q |
| |
|
|||||| |||||||| ||||| | ||||||||||||| ||||||| |||||||||| ||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
31592878 |
acgggttcaagtcctggaaacagcctcttgtgtaaaa-cagggta----aggctgcgtacaatacaccaaa--tggtgggactccttcccggaccctgca |
31592970 |
T |
 |
| Q |
144 |
tatgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
|||| ||||||| | |||||||| | |||||||| |
|
|
| T |
31592971 |
tatgcgggagctctagtgcaccgggttgcccttt |
31593004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 27 - 176
Target Start/End: Complemental strand, 45139623 - 45139479
Alignment:
| Q |
27 |
catgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaa-acagggtagggaaggctgcgtaaaatacaccaaaaatggtgggac |
125 |
Q |
| |
|
||||||||||||| | ||||||| ||||| | ||||| ||||||||||||| |||||||| ||||||| || |||||||||||||||||||||| |
|
|
| T |
45139623 |
catgtgactgaaaggtcacgggttcaagttttggaaacaacctcttgtgtaaaacacagggta----aggctgcatacaatacaccaaaaatggtgggac |
45139528 |
T |
 |
| Q |
126 |
cccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctt |
176 |
Q |
| |
|
|||||||| || |||||||||| |||| |||| |||||||| ||||||||| |
|
|
| T |
45139527 |
cccttcccaga-cctgcgtatgcgggaacttt-gtgcaccgggctgccctt |
45139479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 15 - 167
Target Start/End: Complemental strand, 6411978 - 6411832
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||| ||||| | | || |||| |||||| | |||| | ||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
6411978 |
taaagttgttgtcatgtaactgataggtcatgggttcaagtcttgtaaacagcctcttgtgtaaaaacagggta----aggctgcgtacaatacaccaaa |
6411883 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccga |
167 |
Q |
| |
|
|| |||||||||||||| |||| |||||||| ||||||||| ||||||||| |
|
|
| T |
6411882 |
--tgatgggaccccttcccagaccttgcgtatgcgggagctttagtgcaccga |
6411832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 92 - 178
Target Start/End: Original strand, 15797294 - 15797378
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||||||||||| |||| ||||||| | |||||||| | ||||||||| |
|
|
| T |
15797294 |
aaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttgccctttt |
15797378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 94 - 180
Target Start/End: Complemental strand, 25517251 - 25517167
Alignment:
| Q |
94 |
ggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttttag |
180 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||| |||||||||| |||||||| |||||||| | ||||||||||| |
|
|
| T |
25517251 |
ggctgcgtacaatacac--aaaatggtgggaccccttcccggatcctgcgtatgctggagctttagtgcaccgggttgcccttttag |
25517167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 92 - 178
Target Start/End: Complemental strand, 52926302 - 52926218
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||| ||||||||||||||||||||| ||||||||| | |||||| | ||||||||| |
|
|
| T |
52926302 |
aaggctgcgtacaatacaccaaa--tggtgggacaccttcccggaccctgcgtatgcgggagctttagcgcaccgggttgccctttt |
52926218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 15 - 157
Target Start/End: Original strand, 9607203 - 9607342
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || ||||||||||||| | || ||| |||||||| ||||| | |||||| ||||||| ||||||| |||||||||| |||||||||| |
|
|
| T |
9607203 |
taaagttgttgtcatgtgactgaaaggtcatcggttcaagtcctggaaacagcctcttgcgtaaaaaacagggta----aggctgcgtagaatacaccaa |
9607298 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagcttt |
157 |
Q |
| |
|
|||| |||||||||||||| ||||| || |||| ||||||||| |
|
|
| T |
9607299 |
taatgttgggaccccttcccagaccccgcatatgcgggagcttt |
9607342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 27 - 157
Target Start/End: Original strand, 33926095 - 33926220
Alignment:
| Q |
27 |
catgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggacc |
126 |
Q |
| |
|
||||||||||||| | || |||| |||||||| |||| | |||||||||||||||||||| ||||||| ||| |||||||| | |||||||||||| |
|
|
| T |
33926095 |
catgtgactgaaaggtcatgggttcaagtcctggaaatagcctcttgtgtaaaaacagggt----aaggctgtgtacaatacacc-ataatggtgggacc |
33926189 |
T |
 |
| Q |
127 |
ccttcccggaccctgcgtatgagggagcttt |
157 |
Q |
| |
|
|||||| ||||||||| |||| | ||||||| |
|
|
| T |
33926190 |
ccttcctggaccctgcatatgcgagagcttt |
33926220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 27 - 158
Target Start/End: Complemental strand, 30928292 - 30928166
Alignment:
| Q |
27 |
catgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaaaatggtgggac |
125 |
Q |
| |
|
||||||||||||| | ||||||| |||||||| ||||| | |||||||||||||| || |||| ||| || |||||||||||||| ||| ||||| |
|
|
| T |
30928292 |
catgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacaaggta----aggttgtgtaaaatacaccaat--tggcgggac |
30928199 |
T |
 |
| Q |
126 |
cccttcccggaccctgcgtatgagggagctttg |
158 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| |
|
|
| T |
30928198 |
cccttcccggaccctgcatatgtgggagctttg |
30928166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 15 - 106
Target Start/End: Complemental strand, 10870108 - 10870021
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaat |
106 |
Q |
| |
|
|||||||| || ||||||||||||| | ||||||| |||||||| ||||| | |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10870108 |
taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggt----aaggctgcgtaaaat |
10870021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 68 - 146
Target Start/End: Original strand, 47624095 - 47624167
Alignment:
| Q |
68 |
ctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtat |
146 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
47624095 |
ctcttgtgtaaaaacagggta----aggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgtgtat |
47624167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 92 - 178
Target Start/End: Complemental strand, 54374429 - 54374344
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||||| ||| |||||||| |||||||||||||||||||||||||| |||| ||||||||| || |||| |||||| |||| |
|
|
| T |
54374429 |
aaggctgcgtacaatccaccaaaa-tggtgggaccccttcccggaccctgcatatgcgggagctttagttcaccaggctgccatttt |
54374344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 97 - 166
Target Start/End: Complemental strand, 829521 - 829453
Alignment:
| Q |
97 |
tgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||| |||||||||||| |||||||| |||||||| |
|
|
| T |
829521 |
tgcgtacaatacaccaaaa-tggtgggaccccttcccgaaccctgcgtatgcaggagctttagtgcaccg |
829453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 114 - 178
Target Start/End: Complemental strand, 24851364 - 24851300
Alignment:
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||| ||||||||| |||||||| | ||||||||| |
|
|
| T |
24851364 |
aaatggtgggaccccttcccggatcctgcatatgcgggagctttagtgcaccgggttgccctttt |
24851300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 15 - 166
Target Start/End: Complemental strand, 7697042 - 7696903
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||||||| ||| | ||||||| |||||||| ||||| ||||||||||| |||||||||| ||||||||||| |||||||| | |
|
|
| T |
7697042 |
taaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctggaaacagtctcttgtgt-aaaacagggt----aaggctgcgtacaatacacc--a |
7696950 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
||||| ||||||||||||| |||| |||| ||||||| | |||||||| |
|
|
| T |
7696949 |
aatgg-----ccccttcccggacactgcatatgtgggagctctagtgcaccg |
7696903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 92 - 166
Target Start/End: Complemental strand, 45948921 - 45948849
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
|||||||| || |||||||||| ||||||||||||||| ||||||||||||||| ||||||||| |||||||| |
|
|
| T |
45948921 |
aaggctgcatacaatacaccaat--tggtgggaccccttctcggaccctgcgtatgcgggagctttagtgcaccg |
45948849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 51 - 180
Target Start/End: Complemental strand, 12914156 - 12914032
Alignment:
| Q |
51 |
caagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgag |
149 |
Q |
| |
|
|||||||| ||||| | |||||||||||||| ||||||| |||| ||||| ||||||||||| ||||| ||||||||||| |||||||| |||| | |
|
|
| T |
12914156 |
caagtcctggaaacagcctcttgtgtaaaaaacagggta----aggcggcgtacaatacaccaaa--tggtgagaccccttcccagaccctgcatatgcg |
12914063 |
T |
 |
| Q |
150 |
ggagctttggtgcaccgagctgcccttttag |
180 |
Q |
| |
|
||||||| ||||||| | ||||||||||| |
|
|
| T |
12914062 |
ggagcttcaatgcaccgggttgcccttttag |
12914032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 117 - 179
Target Start/End: Original strand, 30452892 - 30452954
Alignment:
| Q |
117 |
tggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||| | |||||||| | |||||||||| |
|
|
| T |
30452892 |
tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttta |
30452954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 122 - 179
Target Start/End: Complemental strand, 10484671 - 10484614
Alignment:
| Q |
122 |
ggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||| |||||||| | |||||||||| |
|
|
| T |
10484671 |
ggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgccctttta |
10484614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 44403619 - 44403554
Alignment:
| Q |
113 |
aaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| | |||||| |||||||| |||||| |||| |
|
|
| T |
44403619 |
aaaatggtgggaccccttcccggaccctacgtatgctgaagctttagtgcaccgggctgccttttt |
44403554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 96 - 173
Target Start/End: Original strand, 55401254 - 55401330
Alignment:
| Q |
96 |
ctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcc |
173 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||| |||||| | |||||| ||||||||| ||||||| |||||| |
|
|
| T |
55401254 |
ctgcgtataatacaccaaaa-tggtgggaccccttctcggaccttccgtatgcgggagcttttttgcaccgggctgcc |
55401330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 113 - 179
Target Start/End: Original strand, 40968611 - 40968677
Alignment:
| Q |
113 |
aaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
||||||||| |||||||||| |||||| | |||| ||||||||| ||||| ||||||||||||||| |
|
|
| T |
40968611 |
aaaatggtgagaccccttcctagaccctacatatgcgggagctttagtgcatcgagctgccctttta |
40968677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 129 - 178
Target Start/End: Original strand, 47624208 - 47624257
Alignment:
| Q |
129 |
ttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||| | ||||||||| |
|
|
| T |
47624208 |
ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
47624257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 50625013 - 50624952
Alignment:
| Q |
117 |
tggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||| |||||| || ||||||||| | ||||||||| |||||||| ||||||||||| |
|
|
| T |
50625013 |
tggtgggacgccttcctgggccctgcgtaagtgggagctttagtgcaccgggctgccctttt |
50624952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 124 - 179
Target Start/End: Complemental strand, 45416986 - 45416932
Alignment:
| Q |
124 |
accccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
|||||||||||||||||||||||| | |||||| |||||||| |||||||||||| |
|
|
| T |
45416986 |
accccttcccggaccctgcgtatgcagaagcttt-gtgcaccgggctgccctttta |
45416932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 92 - 157
Target Start/End: Original strand, 9276338 - 9276400
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagcttt |
157 |
Q |
| |
|
||||||||||| ||||||||||| |||||| |||| ||||||||||||||||||| |||| |||| |
|
|
| T |
9276338 |
aaggctgcgtacaatacaccaaa--tggtgg-accctttcccggaccctgcgtatgcgggaacttt |
9276400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 31 - 156
Target Start/End: Original strand, 12525423 - 12525543
Alignment:
| Q |
31 |
tgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaaaatggtgggacccct |
129 |
Q |
| |
|
||||||||| | ||| ||| | |||||| ||||| | |||||||||||||| ||||||| |||||||| || |||||||||||||||||||| ||| |
|
|
| T |
12525423 |
tgactgaaaggtcacaggttcgagtcctggaaacagcctcttgtgtaaaaatcagggta----aggctgcg--aagtacaccaaaaatggtgggacacct |
12525516 |
T |
 |
| Q |
130 |
tcccggaccctgcgtatgagggagctt |
156 |
Q |
| |
|
||| ||||||| |||| |||||||| |
|
|
| T |
12525517 |
tcctagaccctgtgtatacgggagctt |
12525543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 114 - 156
Target Start/End: Complemental strand, 46170030 - 46169988
Alignment:
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctt |
156 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||| |||||||| |
|
|
| T |
46170030 |
aaatggtaggaccccttcccggaccctgcatatgtgggagctt |
46169988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 134 - 180
Target Start/End: Complemental strand, 54032614 - 54032568
Alignment:
| Q |
134 |
ggaccctgcgtatgagggagctttggtgcaccgagctgcccttttag |
180 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||| | ||||||||||| |
|
|
| T |
54032614 |
ggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttag |
54032568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 134 - 178
Target Start/End: Complemental strand, 4495719 - 4495675
Alignment:
| Q |
134 |
ggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||| | ||||||||| |
|
|
| T |
4495719 |
ggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
4495675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 114 - 174
Target Start/End: Original strand, 35417998 - 35418058
Alignment:
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccc |
174 |
Q |
| |
|
|||||||||||||||||||||||||| || ||| | ||||||| ||||| || ||||||| |
|
|
| T |
35417998 |
aaatggtgggaccccttcccggaccccgcaaatgcgagagctttagtgcatcgggctgccc |
35418058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 134 - 178
Target Start/End: Complemental strand, 43956515 - 43956471
Alignment:
| Q |
134 |
ggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||| ||||||| ||||||||| |||||||| ||||||||||| |
|
|
| T |
43956515 |
ggacccagcgtatgcgggagctttagtgcaccgggctgccctttt |
43956471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 113
Target Start/End: Complemental strand, 45620986 - 45620890
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgta--aaaacagggtagggaaggctgcgtaaaatacacca |
112 |
Q |
| |
|
|||||||| || || |||||||||| | ||||||| ||||| || ||||| | |||||||||| |||||||||| ||||||||||| ||||||||| |
|
|
| T |
45620986 |
taaagttgttgtcacgtgactgaaaggtcacgggttcaagttctggaaacagcctcttgtgtaaaaaaacagggt----aaggctgcgtacaatacacca |
45620891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 81; Significance: 3e-38; HSPs: 52)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 15 - 179
Target Start/End: Original strand, 38879559 - 38879720
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || ||||||||||||| | ||||||| |||||||| ||||| | ||||||| |||||| ||||||| |||||||||| |||||||||| |
|
|
| T |
38879559 |
taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggta----aggctgcgtacaatacaccaa |
38879654 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |||||||| | |||||||||| |
|
|
| T |
38879655 |
taatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttta |
38879720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 15 - 178
Target Start/End: Original strand, 43334180 - 43334340
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa--cagggtagggaaggctgcgtaaaatacacca |
112 |
Q |
| |
|
|||||||| || ||||||||||||| | ||||||| |||||||| ||||| | ||| |||||||||| ||||||| |||||||||| ||||||||| |
|
|
| T |
43334180 |
taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcctgtgtaaaaaaacagggta----aggctgcgtacaatacacca |
43334275 |
T |
 |
| Q |
113 |
aaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||||||||| |||||||| | ||||||||| |
|
|
| T |
43334276 |
aaaatggtgggaccccttcccggaccctgcg-atgcgggagctttagtgcaccgggttgccctttt |
43334340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 15 - 157
Target Start/End: Original strand, 27328730 - 27328869
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || ||||||||||||| | ||| ||| |||||||| ||||| |||||||||||||||| ||||||| |||||||||| |||||||||| |
|
|
| T |
27328730 |
taaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagtctcttgtgtaaaaaacagggta----aggctgcgtacaatacaccaa |
27328825 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagcttt |
157 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
27328826 |
taatggtgggaccccttcccgaaccctgcgtatgcgggagcttt |
27328869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 15 - 179
Target Start/End: Original strand, 41014297 - 41014455
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || |||||||||| || | ||||||| |||||||| ||||| | |||||||||||||||||||| ||||||||||| |||||||| | |
|
|
| T |
41014297 |
taaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggt----aaggctgcgtacaatacacc--a |
41014390 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
|||||||||||||||||| |||||| || |||| ||||||||| |||||||| | |||||||||| |
|
|
| T |
41014391 |
aatggtgggaccccttcctggaccccgcatatgcgggagctttagtgcaccgggttgccctttta |
41014455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 22 - 180
Target Start/End: Original strand, 32703409 - 32703560
Alignment:
| Q |
22 |
ggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtg |
121 |
Q |
| |
|
|||| ||||||||||||| | ||||||| |||||||| ||||| | ||||||||||||| ||||||| |||||||||| ||||||||||| ||||| |
|
|
| T |
32703409 |
ggtgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa-cagggta----aggctgcgtacaatacaccaaa--tggtg |
32703501 |
T |
 |
| Q |
122 |
ggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttttag |
180 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||| | |||||||| | ||||||||||| |
|
|
| T |
32703502 |
ggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttttag |
32703560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 15 - 179
Target Start/End: Complemental strand, 4619263 - 4619102
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || |||||||||| || | ||||||| |||||||| |||| | |||||||||||||| ||||||| |||||||||| |||||||||| |
|
|
| T |
4619263 |
taaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaatagcctcttgtgtaaaaaacagggta----aggctgcgtacaatacaccaa |
4619168 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
||||||||||||||||||||||||| || |||| | ||||||| |||||||| | |||||||||| |
|
|
| T |
4619167 |
taatggtgggaccccttcccggaccccgcatatgcgagagctttagtgcaccgggttgccctttta |
4619102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 15 - 178
Target Start/End: Original strand, 24448868 - 24449026
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtaggg-aaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || |||||||||| || | ||||||| |||||||| ||||| | || ||||||||||| ||||| ||||||||||| |||||||||| |
|
|
| T |
24448868 |
taaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagccttttgtgtaaaaaa----tagggtaaggctgcgtacaatacaccaa |
24448963 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
| ||||||||||||||||||||||||||||||| |||||||| |||||||| | ||||||||| |
|
|
| T |
24448964 |
a--tggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcaccgggttgccctttt |
24449026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 15 - 178
Target Start/End: Complemental strand, 8170139 - 8169983
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || |||||||| |||| | ||||||| |||||||| ||||| | || |||||||||| ||||||| |||||||||| ||||||||||| |
|
|
| T |
8170139 |
taaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagccttttgtgtaaaa-cagggta----aggctgcgtacaatacaccaaa |
8170045 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||| || |||||||| | ||||||||| |
|
|
| T |
8170044 |
--tggtgggaccccttcccggaccctgcatatgcgggagtttcagtgcaccgggttgccctttt |
8169983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 97 - 177
Target Start/End: Complemental strand, 12575739 - 12575660
Alignment:
| Q |
97 |
tgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||| |||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
12575739 |
tgcgtacaatacaccaaaa-tggtgggaccccttcctggaccctgcgtatgcaggagctttggtgcaccgggctgcccttt |
12575660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 46 - 177
Target Start/End: Complemental strand, 13801895 - 13801767
Alignment:
| Q |
46 |
gggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgt |
144 |
Q |
| |
|
|||| |||||||| ||| | | |||||||||||||| ||||||| |||||||||| |||||||||| ||||||||||||||||||||||||| || | |
|
|
| T |
13801895 |
gggttcaagtcctggaagcagcctcttgtgtaaaaaacagggta----aggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcat |
13801800 |
T |
 |
| Q |
145 |
atgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
||| | ||||||| |||||||| | |||||||| |
|
|
| T |
13801799 |
atgcgagagctttagtgcaccgggttgcccttt |
13801767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 4 - 178
Target Start/End: Complemental strand, 19143110 - 19142942
Alignment:
| Q |
4 |
tggctcaatgataaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaa |
103 |
Q |
| |
|
|||| ||||| |||| ||| || || |||||| ||| | ||| ||| |||||||| ||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
19143110 |
tggcgcaatggtaaaattgttgtcacgtgactaaaatgccacaggttcaagtcctggaaacaacctcttgtgtaaaaacagggta----aggctgcgtac |
19143015 |
T |
 |
| Q |
104 |
aatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
| ||||||||| |||||||||||||||||||||| |||||||| ||||| ||| |||||| | |||||||||| |
|
|
| T |
19143014 |
agtacaccaaa--tggtgggaccccttcccggaccatgcgtatgcgggagatttagtgcactggcctgccctttt |
19142942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 68 - 177
Target Start/End: Complemental strand, 7097863 - 7097760
Alignment:
| Q |
68 |
ctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccga |
167 |
Q |
| |
|
||||||||||||||||||||| ||| |||||| ||||||||||| ||||| |||||||||||| |||||||||||| ||||||||| ||||||| |
|
|
| T |
7097863 |
ctcttgtgtaaaaacagggta----aggttgcgtacaatacaccaaa--tggtgagaccccttcccgaaccctgcgtatgcgggagctttagtgcaccat |
7097770 |
T |
 |
| Q |
168 |
gctgcccttt |
177 |
Q |
| |
|
|||||||||| |
|
|
| T |
7097769 |
gctgcccttt |
7097760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 114 - 179
Target Start/End: Original strand, 16957386 - 16957451
Alignment:
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| |||||||| | |||||||||| |
|
|
| T |
16957386 |
aaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttta |
16957451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 106 - 166
Target Start/End: Original strand, 25622524 - 25622584
Alignment:
| Q |
106 |
tacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
25622524 |
tacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccg |
25622584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 51 - 166
Target Start/End: Original strand, 43574620 - 43574730
Alignment:
| Q |
51 |
caagtcctagaaacggtctcttgtgta-aaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgag |
149 |
Q |
| |
|
|||||||| ||||| ||||||||||| ||||||||||| |||||||||| |||| |||||| ||||||||||||||||||||||||||||||| | |
|
|
| T |
43574620 |
caagtcctggaaacaatctcttgtgtagaaaacagggta----aggctgcgtacaatataccaaa--tggtgggaccccttcccggaccctgcgtatgcg |
43574713 |
T |
 |
| Q |
150 |
ggagctttggtgcaccg |
166 |
Q |
| |
|
|||||||| | |||||| |
|
|
| T |
43574714 |
ggagctttagagcaccg |
43574730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 92 - 179
Target Start/End: Original strand, 29334447 - 29334533
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
||||||||||| ||||||||| || ||||||||||| ||||||||||||||||||| |||| |||| ||||||| |||||||||||| |
|
|
| T |
29334447 |
aaggctgcgtacaatacaccagaa-tggtgggacccattcccggaccctgcgtatgtgggatctttaatgcaccgggctgccctttta |
29334533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 15 - 178
Target Start/End: Original strand, 35710291 - 35710447
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||| ||||||| | ||||||| |||||||| ||||| | ||||||||||||| |||||| ||||||||| ||||||||||| |
|
|
| T |
35710291 |
taaagttgttgtcatgtaactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaat-agggta----aggctgcgttcaatacaccaaa |
35710385 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||||||||||||||| | ||| |||| ||||||| | |||||||| | ||||||||| |
|
|
| T |
35710386 |
--tggtgggaccccttcccggaacatgcatatgcgggagctctagtgcaccgggttgccctttt |
35710447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 104 - 176
Target Start/End: Complemental strand, 12006401 - 12006329
Alignment:
| Q |
104 |
aatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctt |
176 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||||| |||| ||||||||| |||||||| | ||||||| |
|
|
| T |
12006401 |
aatacaccaataatggtgggaccccttcccagaccctgcctatgcgggagctttagtgcaccgtgttgccctt |
12006329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 92 - 176
Target Start/End: Original strand, 20135656 - 20135740
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctt |
176 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||||||| || |||| ||||||| |||||||| | ||||||| |
|
|
| T |
20135656 |
aaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcaggagcttcagtgcaccgggttgccctt |
20135740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 69 - 163
Target Start/End: Original strand, 2838811 - 2838899
Alignment:
| Q |
69 |
tcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgca |
163 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||| |||||||| |||||| ||||||||||||||| |||||| | |||||| |
|
|
| T |
2838811 |
tcttgtgtaaaaacagggta----aggctgcgtacaatacaccaaa--tggtgggatcccttctcggaccctgcgtatgcgggagcatcggtgca |
2838899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 117 - 179
Target Start/End: Original strand, 3771414 - 3771476
Alignment:
| Q |
117 |
tggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
||||||||||||||||||||| ||| ||||| ||||||||| |||||||| |||||||||||| |
|
|
| T |
3771414 |
tggtgggaccccttcccggactctgtgtatgtgggagctttagtgcaccgggctgccctttta |
3771476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 52 - 166
Target Start/End: Original strand, 7368413 - 7368520
Alignment:
| Q |
52 |
aagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgaggg |
151 |
Q |
| |
|
||||||| ||||| | ||||||||||||| ||||||| |||||||||| |||||||||| |||||||||||||||||||||||||| |||| ||| |
|
|
| T |
7368413 |
aagtcctggaaacagcctcttgtgtaaaa-cagggta----aggctgcgtacaatacaccaat--tggtgggaccccttcccggaccctgcatatgtggg |
7368505 |
T |
 |
| Q |
152 |
agctttggtgcaccg |
166 |
Q |
| |
|
|||| | |||||||| |
|
|
| T |
7368506 |
agctctagtgcaccg |
7368520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 92 - 178
Target Start/End: Complemental strand, 12477204 - 12477119
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||||| ||||||||| ||||||| ||||||| | |||||||||| |
|
|
| T |
12477204 |
aaggctgcgtacaatacaccaaaa-tggtgggaccccttcccggattctgcgtatgcaagagctttagtgcacccaactgccctttt |
12477119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 92 - 177
Target Start/End: Complemental strand, 34154897 - 34154814
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||||||||||| |||| || |||| | |||||||| | |||||||| |
|
|
| T |
34154897 |
aaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcggtagctctagtgcaccgggttgcccttt |
34154814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 104 - 157
Target Start/End: Complemental strand, 10306546 - 10306494
Alignment:
| Q |
104 |
aatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagcttt |
157 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10306546 |
aatacaccaaaa-tggtgggaccccttcccggaccctgcgtatgcgggagcttt |
10306494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 113 - 174
Target Start/End: Complemental strand, 21784396 - 21784335
Alignment:
| Q |
113 |
aaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccc |
174 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||| ||| |||||||||| ||||| |
|
|
| T |
21784396 |
aaaatggtgggacccctttccggaccctgcgtatgcgggaggtttagtgcaccgagttgccc |
21784335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 15 - 179
Target Start/End: Complemental strand, 209084 - 208925
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||||||| ||| | ||| || |||||||| | ||| ||||||||||||||||||||| ||||||| | ||||||||||| |
|
|
| T |
209084 |
taaagttgttgtcatgtgactaaaaggtcacaagttcaagtcctggcaacaacctcttgtgtaaaaacagggta----aggctgcattcaatacaccaaa |
208989 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
| |||||||||||||||| |||||||| ||||| ||||||| |||||||| || || |||||| |
|
|
| T |
208988 |
a-tggtgggaccccttcctggaccctgggtatgcaagagctttagtgcaccgggcggcactttta |
208925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 92 - 166
Target Start/End: Complemental strand, 16880730 - 16880658
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
||||||||||| ||||||||||| ||||| |||| ||||||||||| |||||||| ||||||||| |||||||| |
|
|
| T |
16880730 |
aaggctgcgtacaatacaccaaa--tggtgtgaccacttcccggaccatgcgtatgcgggagctttagtgcaccg |
16880658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 15 - 166
Target Start/End: Original strand, 39301101 - 39301247
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgta-aaaacagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || ||||| ||||||| | ||||||| |||||| | | ||| |||||||||| ||||||||||| ||| |||||| ||| |||||| |
|
|
| T |
39301101 |
taaagttgttgtcatgttactgaaaggtcacgggttcaagtcttgggaacaacctcttgtgtataaaacagggtaagga----tgcgtataatgcaccaa |
39301196 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
||| ||||||||||||||||||||||| |||||| ||||| ||| |||||||| |
|
|
| T |
39301197 |
aaa-ggtgggaccccttcccggaccctccgtatgtgggag-tttagtgcaccg |
39301247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 19093884 - 19093949
Alignment:
| Q |
113 |
aaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||| |||||||| |||||||| ||||||||||| |
|
|
| T |
19093884 |
aaaatggtatgacccctacccggaccctgcgtatgttggagctttagtgcaccgggctgccctttt |
19093949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 12 - 179
Target Start/End: Complemental strand, 22861826 - 22861667
Alignment:
| Q |
12 |
tgataaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacacc |
111 |
Q |
| |
|
||||||||||| || ||||||||||||| | ||||| | |||||||||||| | ||||||||||||||| | | ||| |||| | |||||| | |
|
|
| T |
22861826 |
tgataaagttgttgtcatgtgactgaaaggtcacggattcaagtcctagaagcagtctcttgtgtaaaa------caagtaagactgctcacaatacatc |
22861733 |
T |
 |
| Q |
112 |
aaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
|||||||||||||||||| || ||||||| |||| ||||||| | ||||||||| |||||||||| |
|
|
| T |
22861732 |
--aaatggtgggaccccttctcgaaccctgcatatgcgggagctctagtgcaccgaattgccctttta |
22861667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 16028683 - 16028623
Alignment:
| Q |
118 |
ggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||||| | |||||||| | ||||||||| |
|
|
| T |
16028683 |
ggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
16028623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 27 - 157
Target Start/End: Original strand, 22600444 - 22600569
Alignment:
| Q |
27 |
catgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaa-acagggtagggaaggctgcgtaaaatacaccaaaaatggtgggac |
125 |
Q |
| |
|
|||||||||| || | |||||| |||||||| ||||| | | |||||||||| |||||||| |||||| ||| ||||||||||| |||||||| |
|
|
| T |
22600444 |
catgtgactggaaggttacgggttcaagtcctggaaacaatattttgtgtaaaacacagggta----aggctgtgtacaatacaccaaa--tggtgggat |
22600537 |
T |
 |
| Q |
126 |
cccttcccggaccctgcgtatgagggagcttt |
157 |
Q |
| |
|
||||||||||| |||||||||| ||||||||| |
|
|
| T |
22600538 |
cccttcccggatcctgcgtatgcgggagcttt |
22600569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 118 - 177
Target Start/End: Complemental strand, 30877623 - 30877564
Alignment:
| Q |
118 |
ggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||||| | |||||||| | |||||||| |
|
|
| T |
30877623 |
ggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttgcccttt |
30877564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 117 - 180
Target Start/End: Original strand, 39801591 - 39801654
Alignment:
| Q |
117 |
tggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttttag |
180 |
Q |
| |
|
||||||||||||||||| |||||| |||||| ||||||||| |||||||| | |||| |||||| |
|
|
| T |
39801591 |
tggtgggaccccttcccagaccctacgtatgcgggagctttagtgcaccgggttgccattttag |
39801654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 92 - 177
Target Start/End: Original strand, 1565484 - 1565566
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
||||||||||| ||| ||||||| ||| |||||||||||||||||||||| |||| |||||| || |||||||| | |||||||| |
|
|
| T |
1565484 |
aaggctgcgtacaatgcaccaaa--tggcgggaccccttcccggaccctgcatatgtgggagc-ttagtgcaccgggttgcccttt |
1565566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 92 - 178
Target Start/End: Complemental strand, 11657783 - 11657698
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||| || |||||||||||| |||||||||||||||||| ||||||| | | |||| |||| || ||||| ||||||||||| |
|
|
| T |
11657783 |
aaggctgcatacaatacaccaaaa-tggtgggaccccttcccgaaccctgcacacgcgggaactttagttcaccgggctgccctttt |
11657698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 121 - 178
Target Start/End: Complemental strand, 10943900 - 10943844
Alignment:
| Q |
121 |
gggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||| |||||||| ||||||||||| |
|
|
| T |
10943900 |
gggaccccttcccggaccctgca-atgcgggagctttagtgcaccgggctgccctttt |
10943844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 114 - 155
Target Start/End: Complemental strand, 21542530 - 21542489
Alignment:
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagct |
155 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
21542530 |
aaatggtgggaccccttcccggactctgcgtatgcgggagct |
21542489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 126 - 179
Target Start/End: Original strand, 32354211 - 32354264
Alignment:
| Q |
126 |
cccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||| |||||||| | |||||||||| |
|
|
| T |
32354211 |
cccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgccctttta |
32354264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 15 - 80
Target Start/End: Complemental strand, 37024711 - 37024646
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaa |
80 |
Q |
| |
|
|||||||| || ||||||||||||| | ||||||| |||||||| ||||| | ||||||||||||| |
|
|
| T |
37024711 |
taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa |
37024646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 27 - 166
Target Start/End: Original strand, 1850630 - 1850763
Alignment:
| Q |
27 |
catgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggacc |
126 |
Q |
| |
|
||||||||||||| | ||||||| ||||||| |||| ||||||||||||||||| || ||| |||||| |||||| |||| |||||||||| |
|
|
| T |
1850630 |
catgtgactgaaaggtcacgggttcaagtcccggaaataacctcttgtgtaaaaacagaata----agggtgcgtacaatacatcaaa--tggtgggacc |
1850723 |
T |
 |
| Q |
127 |
ccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
||||| |||||||||| ||| || |||||| |||||||| |
|
|
| T |
1850724 |
acttcctggaccctgcggatgcggaagctttagtgcaccg |
1850763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 15 - 178
Target Start/End: Complemental strand, 28516591 - 28516432
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || || ||| |||||| | ||||||| |||||| | ||||| |||||||||||||| |||| ||||| ||||||| |||||| ||| |
|
|
| T |
28516591 |
taaagttgttgtcaggtggctgaaaggtcacgggttcaagtcttggaaacatcctcttgtgtaaaaaacaggctaggg----ctgcgtacaatacatcaa |
28516496 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|| ||||||||||| ||||| ||||||||| ||| |||||||| ||| ||| | ||||||||| |
|
|
| T |
28516495 |
aa-tggtgggacccattcccagaccctgcgcatgcaggagctttagtggaccaggttgccctttt |
28516432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 113 - 171
Target Start/End: Complemental strand, 4654479 - 4654421
Alignment:
| Q |
113 |
aaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctg |
171 |
Q |
| |
|
|||||||||||| |||||| || ||||||| |||| ||||||||| ||||||| ||||| |
|
|
| T |
4654479 |
aaaatggtgggatcccttctcgaaccctgcatatgcgggagctttagtgcaccaagctg |
4654421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 126 - 175
Target Start/End: Original strand, 13774949 - 13774998
Alignment:
| Q |
126 |
cccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccct |
175 |
Q |
| |
|
||||| |||||||||||||||| ||||||||| |||||||| ||| |||| |
|
|
| T |
13774949 |
ccctttccggaccctgcgtatgcgggagctttagtgcaccgggctaccct |
13774998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 129
Target Start/End: Complemental strand, 22908008 - 22907913
Alignment:
| Q |
28 |
atgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccc |
127 |
Q |
| |
|
|||||||||||| | || |||| ||||||| |||||| | ||||||||||||||||| || |||| ||| || |||||||| |||||||||||||| |
|
|
| T |
22908008 |
atgtgactgaaaggtcaagggttcaagtccaagaaacagcctcttgtgtaaaaacagagt----aaggttgcatacaatacacc--aaatggtgggaccc |
22907915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 117 - 178
Target Start/End: Complemental strand, 24903756 - 24903695
Alignment:
| Q |
117 |
tggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||| ||||||||||||||| |||| || | |||| ||||||||||||| |||| |||||| |
|
|
| T |
24903756 |
tggtgagaccccttcccggacactgcatacgcgggaactttggtgcaccgggctgtcctttt |
24903695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 104 - 173
Target Start/End: Complemental strand, 39079823 - 39079755
Alignment:
| Q |
104 |
aatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcc |
173 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| || |||| ||||| ||| |||||| | |||||| |
|
|
| T |
39079823 |
aatacaccaaaa-tggtgggaccccttcccggaccatgtgtatacgggagttttagtgcacagggctgcc |
39079755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 92 - 166
Target Start/End: Complemental strand, 42924917 - 42924841
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccgg--accctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
|||| |||||| ||||||||||||||| ||| | |||||||| | |||||||||||| || |||||| |||||||| |
|
|
| T |
42924917 |
aaggttgcgtacaatacaccaaaaatgatggaatcccttcccagacaccctgcgtatgcggaagctttagtgcaccg |
42924841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 179
Target Start/End: Complemental strand, 24313645 - 24313570
Alignment:
| Q |
104 |
aatacaccaaaaatggtgggaccccttcccgg-accctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| || || ||||| | |||||| |||||||| |||||||||||| |
|
|
| T |
24313645 |
aatacaccaaaa-tggtgggaccccttcccggcgccatgtgtatgctgtagctttagtgcaccgggctgccctttta |
24313570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 179
Target Start/End: Complemental strand, 24355982 - 24355907
Alignment:
| Q |
104 |
aatacaccaaaaatggtgggaccccttcccgg-accctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| || || ||||| | |||||| |||||||| |||||||||||| |
|
|
| T |
24355982 |
aatacaccaaaa-tggtgggaccccttcccggcgccatgtgtatgctgtagctttagtgcaccgggctgccctttta |
24355907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 114 - 166
Target Start/End: Original strand, 30006397 - 30006449
Alignment:
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| ||||||||| |||||||| |
|
|
| T |
30006397 |
aaatggtgggaccccttcccggggcctatgtatgcgggagctttagtgcaccg |
30006449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 80; Significance: 1e-37; HSPs: 30)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 27 - 178
Target Start/End: Complemental strand, 29356002 - 29355854
Alignment:
| Q |
27 |
catgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaa-aaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggac |
125 |
Q |
| |
|
||||||||||||| | ||||||| |||||||| ||||| | ||||||||||| |||||||||| |||||||||| |||||||||| ||||||||||| |
|
|
| T |
29356002 |
catgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaagaaacagggta----aggctgcgtacaatacaccaataatggtgggac |
29355907 |
T |
 |
| Q |
126 |
cccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||| | ||||||||| |
|
|
| T |
29355906 |
cccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
29355854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 15 - 178
Target Start/End: Complemental strand, 12222074 - 12221913
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || ||||||||||||| | ||||||| |||||| | ||||| | |||||||||||||| ||||||| |||||||||| |||||||||| |
|
|
| T |
12222074 |
taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcttggaaacagcctcttgtgtaaaaaacagggta----aggctgcgtacaatacaccaa |
12221979 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagc-tttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| ||| |||||||| | ||||||||| |
|
|
| T |
12221978 |
taatggtgggaccccttcccggaccctgcgtatgcgggagcttttagtgcaccgggttgccctttt |
12221913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 15 - 178
Target Start/End: Original strand, 9161101 - 9161260
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||||||||||| | ||| ||| |||||||| ||||| | ||||||||||||||||| ||| |||||||||| |||||| ||| |
|
|
| T |
9161101 |
taaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaaacagagta----aggctgcgtacaatacatcaat |
9161196 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || |||||| ||||||| | ||||||||| |
|
|
| T |
9161197 |
aatggtgggaccccttctcggaccctgcgtatgcggaagctttagtgcaccaggttgccctttt |
9161260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 15 - 179
Target Start/End: Complemental strand, 1354912 - 1354755
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||||||||||| | ||| ||| |||||||| ||||| | ||||||||||||| ||||||| |||||||||| ||||||||||| |
|
|
| T |
1354912 |
taaagttgttgtcatgtgactgaaaggtcactggttcaagtcctggaaacagcctcttgtgtaaaa-cagggta----aggctgcgtacaatacaccaaa |
1354818 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||| | |||||||| | |||||||||| |
|
|
| T |
1354817 |
--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttta |
1354755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 15 - 178
Target Start/End: Original strand, 1346942 - 1347098
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||||||||||| | ||||||| |||||||| ||||| | | ||||||||||| ||||||| |||||||||| ||||||||||| |
|
|
| T |
1346942 |
taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagccacttgtgtaaaa-cagggta----aggctgcgtacaatacaccaaa |
1347036 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||| | |||||||| | ||||||||| |
|
|
| T |
1347037 |
--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
1347098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 96 - 179
Target Start/End: Original strand, 12885967 - 12886050
Alignment:
| Q |
96 |
ctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||| ||||||||||||| ||||||||| |||||||| | |||||||||| |
|
|
| T |
12885967 |
ctgcgtacaatacacaaaaaatggtgggaccccttcccagaccctgcgtatgtgggagctttagtgcaccgggttgccctttta |
12886050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 15 - 178
Target Start/End: Complemental strand, 2166569 - 2166409
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaa-acagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || |||||||||||| | ||||||| |||||||| ||||| ||||||||||||| ||||| || ||| |||||| |||||||||| |
|
|
| T |
2166569 |
taaagttgttgttatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaatacaggata----aggttgcgtacaatacaccaa |
2166474 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||||| |||||||| | ||||||||| |
|
|
| T |
2166473 |
taatggtgggaccccttcccggaccctatatattcgggagctttagtgcaccgggttgccctttt |
2166409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 15 - 178
Target Start/End: Complemental strand, 2178202 - 2178042
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaa-acagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || |||||||||||| | ||||||| |||||||| ||||| ||||||||||||| ||||| || ||| |||||| |||||||||| |
|
|
| T |
2178202 |
taaagttgttgttatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaatacaggata----aggttgcgtacaatacaccaa |
2178107 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||||| |||||||| | ||||||||| |
|
|
| T |
2178106 |
taatggtgggaccccttcccggaccctatatattcgggagctttagtgcaccgggttgccctttt |
2178042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 97 - 178
Target Start/End: Original strand, 12892064 - 12892145
Alignment:
| Q |
97 |
tgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||||||||||| || |||| ||||||||| |||||||| | ||||||||| |
|
|
| T |
12892064 |
tgcgtataatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
12892145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 92 - 177
Target Start/End: Complemental strand, 7947455 - 7947371
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
||||||||||| |||||||||||| ||||||| |||||||||||||| |||||||| ||||||||| |||||| |||||||||| |
|
|
| T |
7947455 |
aaggctgcgtacaatacaccaaaa-tggtgggcccccttcccggaccttgcgtatgtgggagctttagtgcacttggctgcccttt |
7947371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 115 - 178
Target Start/End: Original strand, 6808468 - 6808531
Alignment:
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||||||| |||||||| | ||||||||| |
|
|
| T |
6808468 |
aatggtgggaccccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgccctttt |
6808531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 116 - 179
Target Start/End: Complemental strand, 23930188 - 23930125
Alignment:
| Q |
116 |
atggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
|||||||||||||||| |||||||||| |||| ||||||||| |||||||||| |||||||||| |
|
|
| T |
23930188 |
atggtgggaccccttcacggaccctgcttatgcgggagctttagtgcaccgagttgccctttta |
23930125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 104 - 166
Target Start/End: Complemental strand, 3116202 - 3116140
Alignment:
| Q |
104 |
aatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |||||||| ||||||||| || ||||| |
|
|
| T |
3116202 |
aatacaccaaaaatggtgggaccccttctcggaccttgcgtatgcgggagctttagtacaccg |
3116140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 117 - 177
Target Start/End: Complemental strand, 10734965 - 10734905
Alignment:
| Q |
117 |
tggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||||||| || ||||| |||||||||| |
|
|
| T |
10734965 |
tggtgggcccccttcccggaccctgcgtatgcgggagctttagtccaccgggctgcccttt |
10734905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 114 - 178
Target Start/End: Original strand, 13267797 - 13267861
Alignment:
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||| |||||||| | ||||||||| |
|
|
| T |
13267797 |
aaatggtgggaccccttcctggaccctgcgtatgcgggagcttcagtgcaccgggttgccctttt |
13267861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 29 - 177
Target Start/End: Original strand, 17432332 - 17432483
Alignment:
| Q |
29 |
tgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgt-aaaaacagggta--gggaaggctgcgtaaaatacaccaaaaatggtgggac |
125 |
Q |
| |
|
||||||||||| | ||| ||| |||||||| ||||| |||||||| |||||||||||| || ||||||| ||| ||||||| |||||||||| ||| |
|
|
| T |
17432332 |
tgtgactgaaaggtcacaggttcaagtcctggaaacaacatcttgtgtaaaaaacagggtaagggtaaggctgtgtacaatacactaaaaatggtgagac |
17432431 |
T |
 |
| Q |
126 |
cccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
| |||||||| |||| | ||| ||||||||| |||||||| | |||||||| |
|
|
| T |
17432432 |
cttttcccggatcctgtgcatgcgggagctttagtgcaccgggttgcccttt |
17432483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 92 - 178
Target Start/End: Original strand, 26097210 - 26097294
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||||| ||||||||||| || |||||||||||||||||||||| |||| ||||||| | |||||||| | ||||||||| |
|
|
| T |
26097210 |
aaggctgcgtacaatacaccaaa--tgaagggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
26097294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 15 - 166
Target Start/End: Complemental strand, 3815234 - 3815088
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaagg-ctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || ||||||||||||| | ||||||| |||||||| ||||| | || ||||||||||| || || | | ||||||| |||||||||| |
|
|
| T |
3815234 |
taaagttgttgtcatgtgactgaaatgtcacgggttcaagtcctggaaacagactattgtgtaaaaaa----tatggtacgactgcgtacaatacaccaa |
3815139 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
| ||||||||||| |||||| ||||| |||||| || |||||| |||||||| |
|
|
| T |
3815138 |
a--tggtgggaccctttcccgaaccctacgtatgcggaagctttagtgcaccg |
3815088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 117 - 177
Target Start/End: Original strand, 11395836 - 11395895
Alignment:
| Q |
117 |
tggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||| || ||||| |||||||||| |
|
|
| T |
11395836 |
tggtgggaccccttcccggatcctgcgtatgcgggagctttagtccaccg-gctgcccttt |
11395895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 15 - 174
Target Start/End: Complemental strand, 13905136 - 13904984
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgta-aaaacagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || ||||||||||||| | |||||| |||||||| ||||| |||||||||| |||||||||| |||||||| || ||| |||| |
|
|
| T |
13905136 |
taaagttgttgtcatgtgactgaaaggtcacgggctcaagtcctgaaaacgacctcttgtgtaaaaaacagggt----aaggctgcatacaattcacc-- |
13905043 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccc |
174 |
Q |
| |
|
||||||| |||||| |||||| ||||||||||| | |||||||| |||||||| ||||||| |
|
|
| T |
13905042 |
aaatggt-ggaccctttcccgaaccctgcgtatcacggagcttt-gtgcaccgggctgccc |
13904984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 114 - 157
Target Start/End: Original strand, 24097649 - 24097692
Alignment:
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagcttt |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
24097649 |
aaatggtgggaccccttcccggaccctgcgtatgcggaagcttt |
24097692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 92 - 147
Target Start/End: Original strand, 24734694 - 24734749
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatg |
147 |
Q |
| |
|
|||| |||||| |||||| |||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
24734694 |
aaggttgcgtacaatacaacaaaaaaggtgggaccccttcccggatcctgcgtatg |
24734749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 92 - 178
Target Start/End: Original strand, 25557775 - 25557859
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||||| ||||||||||| || || ||||||||||||||||||| |||| ||||||| | |||||||| | ||||||||| |
|
|
| T |
25557775 |
aaggctgcgtacaatacaccaaa--tgaaggaaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
25557859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 104 - 166
Target Start/End: Complemental strand, 14975163 - 14975101
Alignment:
| Q |
104 |
aatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||| || |||| ||||| ||| |||||||| |
|
|
| T |
14975163 |
aatacaccaataatggtgggaccccttcccgaaccccgcatatgcgggagttttagtgcaccg |
14975101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 15 - 175
Target Start/End: Complemental strand, 15866194 - 15866041
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| |||||||||| ||||| | || |||| ||| |||| ||||| | ||||| ||||||| ||||||| | ||||||||| |||||||| |
|
|
| T |
15866194 |
taaagttgttggcatgtgattgaaaggtcatgggttcaattcctggaaacagcctcttaagtaaaaaacagggta----aagctgcgtaa--tacaccaa |
15866101 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccct |
175 |
Q |
| |
|
| |||||||||||||||||||||||||||| || |||| || | |||||| ||| |||||| |
|
|
| T |
15866100 |
a--tggtgggaccccttcccggaccctgcgtttgcgggatctatagtgcactgagttgccct |
15866041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 15 - 139
Target Start/End: Original strand, 6024211 - 6024332
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || ||||||| || || | ||||| | ||| |||||||||| | |||||||||||||| || |||| || ||||||| |||||||||| |
|
|
| T |
6024211 |
taaagttgttgtcatgtgattggaaggtcacggtttcaaatcctagaaacagcctcttgtgtaaaaaacatggta----agactgcgtacaatacaccaa |
6024306 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccc |
139 |
Q |
| |
|
|||| ||||||| |||||||||||| |
|
|
| T |
6024307 |
taatgatgggacctcttcccggaccc |
6024332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 92 - 155
Target Start/End: Original strand, 14553563 - 14553626
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagct |
155 |
Q |
| |
|
||||||| ||| |||||||||||| ||||||||||||||| ||||||| ||||| ||||||| |
|
|
| T |
14553563 |
aaggctgtgtataatacaccaaaactggtgggaccccttcgtagaccctgtgtatgcgggagct |
14553626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 114 - 157
Target Start/End: Original strand, 32579497 - 32579540
Alignment:
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagcttt |
157 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||| ||||||||| |
|
|
| T |
32579497 |
aaatggtgggaccccttcccagaccctgcatatgcgggagcttt |
32579540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 92 - 133
Target Start/End: Complemental strand, 2755507 - 2755466
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttccc |
133 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
2755507 |
aaggctgcgtacaatacaccaaaaatggtgggagtccttccc |
2755466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 98 - 177
Target Start/End: Complemental strand, 383837 - 383760
Alignment:
| Q |
98 |
gcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
||||| ||||||||||| | ||||||||||||| | ||||||||||||| |||||||| || ||||| | |||||||| |
|
|
| T |
383837 |
gcgtacaatacaccaaa--ttgtgggaccccttctcagaccctgcgtatgcgggagcttcagtccaccgggttgcccttt |
383760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 75; Significance: 1e-34; HSPs: 49)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 15 - 177
Target Start/End: Original strand, 13160680 - 13160836
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || |||||||||| || | ||||||| |||||||||||||| | |||||||||||||||||||| ||||||||||| |||||||| | |
|
|
| T |
13160680 |
taaagttgttgtcatgtgactgtaaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaaacagggt----aaggctgcgtacaatacacc--a |
13160773 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| |||| ||| | |||||||| |
|
|
| T |
13160774 |
aatggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcgccgggttgcccttt |
13160836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 15 - 179
Target Start/End: Complemental strand, 39461153 - 39460992
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || |||| |||||||| | ||||||| |||||||| ||||| | |||||||||||||| ||| ||| |||||||||| |||||||||| |
|
|
| T |
39461153 |
taaagttgttgtcatgagactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagagta----aggctgcgtacaatacaccaa |
39461058 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||||||||| |||||||| | |||||||||| |
|
|
| T |
39461057 |
taatggtgagaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttta |
39460992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 15 - 166
Target Start/End: Complemental strand, 21070859 - 21070708
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||||||||||| | ||||||| |||||||| ||||| | ||||||| |||||| | || ||||||||||| |||||||||| |
|
|
| T |
21070859 |
taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaaaaaaagggtaaggctgcgtacaatacaccaat |
21070760 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| ||| |||||||| |
|
|
| T |
21070759 |
aatggtgggaccccttcccggaccctgcgtatgcgggagttttagtgcaccg |
21070708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 15 - 166
Target Start/End: Complemental strand, 20284230 - 20284080
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtaggg-aaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || ||||||||||||| | ||||||| |||||||| ||||| | ||||||| |||||| | |||| ||||||||||| |||||||||| |
|
|
| T |
20284230 |
taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaaaaa--agggtaaggctgcgtacaatacaccaa |
20284133 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| ||| |||||||| |
|
|
| T |
20284132 |
taatggtgggaccccttcccggaccctgcgtatgcgggagttttagtgcaccg |
20284080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 15 - 179
Target Start/End: Original strand, 36720774 - 36720933
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || |||||||||| || | ||||||| |||||||| ||||| | |||||||||||||| ||||||| |||||||||| |||||||||| |
|
|
| T |
36720774 |
taaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta----aggctgcgtacaatacaccaa |
36720869 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
| ||||||||||||||||||||||||||||||| || |||||| ||||||| | |||||||||| |
|
|
| T |
36720870 |
a--tggtgggaccccttcccggaccctgcgtatgcggaagctttagtgcacccggttgccctttta |
36720933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 15 - 178
Target Start/End: Complemental strand, 28817783 - 28817625
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || |||||||||| || | ||||||| |||||||| ||||| | |||||||||||||| ||||||| |||||||||| |||||||| | |
|
|
| T |
28817783 |
taaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta----aggctgcgtacaatacaccca |
28817688 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
| ||||||||||||||||||||||||||||||| ||||||||| ||||| || | ||||||||| |
|
|
| T |
28817687 |
a--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcatcgggttgccctttt |
28817625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 15 - 178
Target Start/End: Original strand, 35261657 - 35261815
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || |||||||||| || | ||||||| |||| ||| ||||| |||||||||||||||| ||||||| ||| |||||| |||||||||| |
|
|
| T |
35261657 |
taaagttgttgtcatgtgactggaaggtcacgggttcaagccctggaaacagtctcttgtgtaaaaaacagggta----aggttgcgtacaatacaccaa |
35261752 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
| |||||||||||||||| |||||||||||||| ||||||||| |||||||| | ||||||||| |
|
|
| T |
35261753 |
a--tggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
35261815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 15 - 166
Target Start/End: Complemental strand, 12670405 - 12670261
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||||||||||| | ||||||| |||||||| ||||| | ||||||||||||| ||||||| |||||||||| ||||||||||| |
|
|
| T |
12670405 |
taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa-cagggta----aggctgcgtacaatacaccaaa |
12670311 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||| | |||||||| |
|
|
| T |
12670310 |
--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccg |
12670261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 15 - 176
Target Start/End: Original strand, 45071243 - 45071398
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||||| || || | ||||||| ||||| || ||||| | ||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
45071243 |
taaagttgttgtcatgtgattgtaaggtcacgggttcaagttctggaaacagcctcttgtgtaaaaacagggta----aggctgcgtacaatacaccaaa |
45071338 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctt |
176 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||||| |||||||| | ||||||| |
|
|
| T |
45071339 |
--tggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttgccctt |
45071398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 15 - 166
Target Start/End: Complemental strand, 7136686 - 7136538
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaac-agggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || |||||||||| || | || |||| |||||||| ||||| ||||||||||||||| |||||| |||||||||| |||||||||| |
|
|
| T |
7136686 |
taaagttgttgtcatgtgactggaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaaccagggta----aggctgcgtacaatacaccaa |
7136591 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
||||||||||||||||||||||||| || |||| ||||||||| |||||||| |
|
|
| T |
7136590 |
taatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccg |
7136538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 15 - 178
Target Start/End: Complemental strand, 30454252 - 30454096
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||||||||||| | ||||||| |||||||| ||||| | ||||||||||||| || |||| |||||||||| |||||||||| |
|
|
| T |
30454252 |
taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa-caaggta----aggctgcgtacgatacaccaaa |
30454158 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||| | |||||||| | ||||||||| |
|
|
| T |
30454157 |
--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
30454096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 15 - 158
Target Start/End: Complemental strand, 24365217 - 24365078
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa--cagggtagggaaggctgcgtaaaatacacca |
112 |
Q |
| |
|
|||||||| || ||||||||| ||| | ||||||| |||| ||||||||| | |||||||||||||| ||||||| |||||||| | ||||||||| |
|
|
| T |
24365217 |
taaagttgttgtcatgtgactaaaatgtcacgggttcaagccctagaaacagcctcttgtgtaaaaaatcagggta----aggctgcgaacaatacacca |
24365122 |
T |
 |
| Q |
113 |
aaaatggtgggaccccttcccggaccctgcgtatgagggagctttg |
158 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
24365121 |
aa--tggtgggaccccttcccggaccctgcgtatgtgggagctttg |
24365078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 15 - 175
Target Start/End: Complemental strand, 44781663 - 44781506
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaa-acagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || || |||||||||| ||||||| |||||||| ||||| ||||||||||||| |||||||| |||||| ||| |||||||||| |
|
|
| T |
44781663 |
taaagttgttgtcacgtgactgaaagttcacgggttcaagtcctggaaacaacctcttgtgtaaaagacagggta----aggctgtgtacaatacaccaa |
44781568 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccct |
175 |
Q |
| |
|
||||| ||||||||| |||| ||||||||||||| ||||||||| |||||| | |||||||| |
|
|
| T |
44781567 |
aaatgttgggaccccgtcccagaccctgcgtatgcgggagctttagtgcactgtgctgccct |
44781506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 43 - 178
Target Start/End: Original strand, 6760828 - 6760960
Alignment:
| Q |
43 |
cacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctg |
141 |
Q |
| |
|
||||||| |||||||| ||||| | |||||||||||||| ||||||| ||||| |||| |||||||||| ||||||||||||||||| ||||||| | |
|
|
| T |
6760828 |
cacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta----aggcttcgtacaatacaccaataatggtgggaccccttctcggaccccg |
6760923 |
T |
 |
| Q |
142 |
cgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
| |||| ||||||||| |||||||| | ||||||||| |
|
|
| T |
6760924 |
catatgcgggagctttagtgcaccgggttgccctttt |
6760960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 55 - 178
Target Start/End: Original strand, 20869941 - 20870061
Alignment:
| Q |
55 |
tcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggag |
153 |
Q |
| |
|
|||| ||||| |||||||||||||||| ||||||| |||||||||| |||||||||| |||||||||||||||||| |||||| || |||| ||||| |
|
|
| T |
20869941 |
tcctggaaacagtctcttgtgtaaaaaacagggta----aggctgcgtacaatacaccaataatggtgggaccccttccaggaccccgcatatgcgggag |
20870036 |
T |
 |
| Q |
154 |
ctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||| |||||||| | ||||||||| |
|
|
| T |
20870037 |
ctttagtgcaccgggttgccctttt |
20870061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 43 - 178
Target Start/End: Complemental strand, 5135418 - 5135289
Alignment:
| Q |
43 |
cacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgc |
142 |
Q |
| |
|
||||||| |||||||| ||||| | |||||||||||||| || | || ||||||| ||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5135418 |
cacgggttcaagtcctggaaacagcctcttgtgtaaaaa-agag--ggtaaggctgtgtacaatacaccaaa--tggtgggaccccttcccggaccctgc |
5135324 |
T |
 |
| Q |
143 |
gtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||| |||||||| |||||||| ||||||||||| |
|
|
| T |
5135323 |
gtatgcaggagcttt-gtgcaccgggctgccctttt |
5135289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 17 - 166
Target Start/End: Complemental strand, 18164914 - 18164771
Alignment:
| Q |
17 |
aagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaa |
116 |
Q |
| |
|
|||||| || ||||||||||||| | ||||||| |||||||| ||||| | ||||||||||||||||||||| ||| |||||| ||||||||||| |
|
|
| T |
18164914 |
aagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggta----aggttgcgtacaatacaccaaag- |
18164820 |
T |
 |
| Q |
117 |
tggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
| || |||| ||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
18164819 |
-gatgtgaccatttcccggaccctgcgtatgcgggagctttagtgcaccg |
18164771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 15 - 179
Target Start/End: Original strand, 44530127 - 44530286
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || ||||||||| || | ||||||| |||||| | ||||| |||||||||||||| ||||||| |||||||||| |||||||||| |
|
|
| T |
44530127 |
taaagttgctgtcatgtgactagaaggtcacgggttcaagtcttggaaacaacctcttgtgtaaaaaacagggta----aggctgcgtacaatacaccaa |
44530222 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
| |||||||||||||||| |||||||||||||| ||||||||| |||||||| | || ||||||| |
|
|
| T |
44530223 |
a--tggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgacctttta |
44530286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 15 - 177
Target Start/End: Original strand, 17823554 - 17823711
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaac-agggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || |||||||| |||| | ||||||| |||||||| ||||| | ||||||||||||||| ||| || || |||||||||||||||||| |
|
|
| T |
17823554 |
taaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaccaggata----agactgcgtaaaatacaccaa |
17823649 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
| |||||| ||||||||||| ||||||| |||| |||||||| |||||||| | |||||||| |
|
|
| T |
17823650 |
a--tggtggaaccccttcccgaaccctgcatatgcaggagctttagtgcaccgggttgcccttt |
17823711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 12 - 166
Target Start/End: Complemental strand, 29521845 - 29521696
Alignment:
| Q |
12 |
tgataaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacac |
110 |
Q |
| |
|
||||||||||| || | |||||||| || | ||||||| |||||||| ||||| | ||||||| |||||| ||||||| |||||||||| ||||||| |
|
|
| T |
29521845 |
tgataaagttgttgtcgtgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtttaaaaaacagggta----aggctgcgtacaatacac |
29521750 |
T |
 |
| Q |
111 |
caaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
|||| |||||||| ||| |||| ||||||||||||| ||||||||| |||||||| |
|
|
| T |
29521749 |
caaa--tggtgggaacccatcccagaccctgcgtatgcgggagctttagtgcaccg |
29521696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 43 - 179
Target Start/End: Original strand, 26954138 - 26954272
Alignment:
| Q |
43 |
cacgggtccaagtcctagaaacggtctcttgtgtaaaaa--cagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccct |
140 |
Q |
| |
|
||||||| |||||||| ||||| | |||||||||||||| ||||||| |||||||||| |||||||||| ||||||||||||||||||| |||| |
|
|
| T |
26954138 |
cacgggttcaagtcctggaaacagcctcttgtgtaaaaaaacagggta----aggctgcgtacaatacaccaataatggtgggaccccttcccagacctc |
26954233 |
T |
 |
| Q |
141 |
gcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
|| |||| ||||||||| |||||| | | |||||||||| |
|
|
| T |
26954234 |
gcatatgcgggagctttagtgcactgggttgccctttta |
26954272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 92 - 175
Target Start/End: Original strand, 29877146 - 29877227
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccct |
175 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| |||||| || ||||||| |||||||| |
|
|
| T |
29877146 |
aaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgcgggagcgttagtgcaccaggctgccct |
29877227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 114 - 179
Target Start/End: Original strand, 12625962 - 12626027
Alignment:
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||||| |||||||| | |||||||||| |
|
|
| T |
12625962 |
aaatggtgggaccccctcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttta |
12626027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 15 - 154
Target Start/End: Complemental strand, 20869653 - 20869523
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||||||||||| | ||||||| |||||||| ||||| | ||||||||| |||||||||| ||||||| ||| |||||||||| |
|
|
| T |
20869653 |
taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt-aaaacagggt----aaggctgtgtacaatacaccaa- |
20869560 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagc |
154 |
Q |
| |
|
|||| |||||||||||||||||||| |||| |||||| |
|
|
| T |
20869559 |
---ggtgagaccccttcccggaccctgcatatgcgggagc |
20869523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 92 - 164
Target Start/End: Complemental strand, 17250960 - 17250888
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcac |
164 |
Q |
| |
|
||||| ||||| |||||||||| ||||||||||||| |||||| ||||||||||||| |||||||| |||||| |
|
|
| T |
17250960 |
aaggcagcgtacaatacaccaataatggtgggaccctttcccgaaccctgcgtatgaaggagctttagtgcac |
17250888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 94 - 178
Target Start/End: Original strand, 25250576 - 25250660
Alignment:
| Q |
94 |
ggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||| |||| || |||| ||||| ||| |||||||| | ||||||||| |
|
|
| T |
25250576 |
ggctgcgtacaatacaccaataatggtgggaccccttcccgaaccccgcatatgcgggagatttagtgcaccgggttgccctttt |
25250660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 15 - 165
Target Start/End: Original strand, 2626497 - 2626645
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || |||||||| |||| | ||||||| |||||||| ||||| | |||||||||||||| | || ||| ||||||| ||||||||||| |
|
|
| T |
2626497 |
taaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaaaaacagggtaagactgcgtacaatacaccaaa |
2626596 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcacc |
165 |
Q |
| |
|
|| |||||||||||||| |||||||| |||| |||||||| ||||||| |
|
|
| T |
2626597 |
--tgatgggaccccttcccagaccctgcatatgcgggagcttcagtgcacc |
2626645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 96 - 166
Target Start/End: Original strand, 16225075 - 16225145
Alignment:
| Q |
96 |
ctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
||||||| |||||||||| |||||||||| |||||||||||||| || |||| ||||||||| |||||||| |
|
|
| T |
16225075 |
ctgcgtacaatacaccaataatggtgggatcccttcccggaccccgcatatgcgggagctttagtgcaccg |
16225145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 97 - 166
Target Start/End: Original strand, 16013511 - 16013580
Alignment:
| Q |
97 |
tgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
|||||| ||||||| |||||||||| ||||||||||| |||||||| |||| ||||||||| |||||||| |
|
|
| T |
16013511 |
tgcgtacaatacactaaaaatggtgcgaccccttcccagaccctgcctatgcgggagctttagtgcaccg |
16013580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 121 - 178
Target Start/End: Original strand, 40444845 - 40444902
Alignment:
| Q |
121 |
gggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
40444845 |
gggaccccttgccggaccctgcgtatgttggagctttagtgcaccgagctgccctttt |
40444902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 15 - 157
Target Start/End: Original strand, 24245429 - 24245564
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||||||||||| | ||||||| |||||||| |||||| |||||| ||||| ||||||| || || |||| ||| ||||||| |
|
|
| T |
24245429 |
taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacg-tctcttatgtaa---cagggta----agactacgtacaatgcaccaaa |
24245520 |
T |
 |
| Q |
115 |
aa-tggtgggaccccttcccggaccctgcgtatgagggagcttt |
157 |
Q |
| |
|
|| | |||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
24245521 |
aaattgtgggaccccttcctggaccctgcgtatgcgggagcttt |
24245564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 114 - 178
Target Start/End: Original strand, 26102589 - 26102653
Alignment:
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||||||| | |||||||| | ||||||||| |
|
|
| T |
26102589 |
aaatggtgggaccccttcccggaccctgcttatgcgggagctctagtgcaccgggttgccctttt |
26102653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 30 - 176
Target Start/End: Complemental strand, 42083841 - 42083699
Alignment:
| Q |
30 |
gtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggacccct |
129 |
Q |
| |
|
|||||||||| | ||||||| |||||||| ||||| | || ||||||||||| ||| | ||||||||||| | || ||||||| ||||||||||||| |
|
|
| T |
42083841 |
gtgactgaaaggtcacgggttcaagtcctggaaacagccttttgtgtaaaaaatggg---gcaaggctgcgtacagtataccaaaa-tggtgggacccct |
42083746 |
T |
 |
| Q |
130 |
tcccggaccctgcgtatgagggagctttggtgcaccgagctgccctt |
176 |
Q |
| |
|
||||| |||||| ||| | ||||||||| ||||| | ||||||||| |
|
|
| T |
42083745 |
tcccgaaccctgtgtacgtgggagctttagtgcattgggctgccctt |
42083699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 92 - 166
Target Start/End: Original strand, 5689683 - 5689755
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
||||||||||| ||||||||||| |||||| ||||||||||| ||| |||||||| ||||||||| |||||||| |
|
|
| T |
5689683 |
aaggctgcgtacaatacaccaaa--tggtggaaccccttcccgaaccatgcgtatgtgggagctttagtgcaccg |
5689755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 92 - 178
Target Start/End: Complemental strand, 8897847 - 8897763
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||| |||| ||||||||||| |||||||||||||||||||||||||| |||| ||||||||| |||||| | ||||||||| |
|
|
| T |
8897847 |
aaggctacgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctttactgcacccggttgccctttt |
8897763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 114 - 177
Target Start/End: Original strand, 28407475 - 28407538
Alignment:
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| ||||||||| ||||||| | |||||||| |
|
|
| T |
28407475 |
aaatggtgggaccccttcccggaccctacgtatgcgggagctttactgcaccgggttgcccttt |
28407538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 117 - 166
Target Start/End: Original strand, 27507985 - 27508034
Alignment:
| Q |
117 |
tggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||| |||||||| |
|
|
| T |
27507985 |
tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccg |
27508034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 15 - 88
Target Start/End: Original strand, 28407394 - 28407467
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggta |
88 |
Q |
| |
|
|||||||| || |||||||||| || | ||||||| |||||||| ||||| | ||||||||||||||||||||| |
|
|
| T |
28407394 |
taaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggta |
28407467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 92 - 133
Target Start/End: Original strand, 43942376 - 43942417
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttccc |
133 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43942376 |
aaggctgcgtacaatacaccaaaaatggtgggaccccttccc |
43942417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 114 - 178
Target Start/End: Complemental strand, 35107374 - 35107310
Alignment:
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||| || |||||| |||||||| | ||||||||| |
|
|
| T |
35107374 |
aaatggtgggaccccttcccggacgctgtgtatgcggaagctttagtgcaccgggttgccctttt |
35107310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 92 - 166
Target Start/End: Complemental strand, 8484021 - 8483949
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||| |||| ||||||||||||| ||||||||| | |||||| |
|
|
| T |
8484021 |
aaggctgcgtacaatacaccaat--tggtgggaccccatcccagaccctgcgtatgcgggagctttagggcaccg |
8483949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 128 - 178
Target Start/End: Complemental strand, 27468141 - 27468091
Alignment:
| Q |
128 |
cttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||| | ||||||||| |
|
|
| T |
27468141 |
cttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
27468091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 92 - 166
Target Start/End: Complemental strand, 44742602 - 44742529
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||| ||||||| || ||| |||||| || |||||||| |
|
|
| T |
44742602 |
aaggctgcgtacaatacaccaaaa-tggtgggaccccttcttggaccctacggatgcgggagcattagtgcaccg |
44742529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 92 - 164
Target Start/End: Original strand, 19729392 - 19729462
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcac |
164 |
Q |
| |
|
||||||| ||| ||||||||||| |||||||||||||||||||||||||| ||| ||||||| | |||||| |
|
|
| T |
19729392 |
aaggctgtgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatacgggagctctagtgcac |
19729462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 92 - 166
Target Start/End: Original strand, 26457781 - 26457851
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||| || |||| |||||||||||||||||| |||||||| |
|
|
| T |
26457781 |
aaggctgcgtacaatacaccaat--tggtgggacccct--cctgaccttgcgtatgagggagctttagtgcaccg |
26457851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 92 - 179
Target Start/End: Original strand, 31457224 - 31457309
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
||||||||||| |||||| |||| |||| |||||||||||| |||||||||||| ||||||| | |||||||| |||||||||| |
|
|
| T |
31457224 |
aaggctgcgtacaatacatcaaa--tggtaggaccccttcccaaaccctgcgtatgcgggagctctagtgcaccggattgccctttta |
31457309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 110 - 163
Target Start/End: Original strand, 18595906 - 18595959
Alignment:
| Q |
110 |
ccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgca |
163 |
Q |
| |
|
||||||||| | |||||||||||||||||||| ||||| ||||| ||| ||||| |
|
|
| T |
18595906 |
ccaaaaatgataggaccccttcccggaccctgtgtatgcgggagttttagtgca |
18595959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 166
Target Start/End: Original strand, 389649 - 389769
Alignment:
| Q |
43 |
cacgggtccaagtcctagaaacggtctcttgtgt---aaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccc |
139 |
Q |
| |
|
||||||| |||||||| ||||| ||||||||| |||||||||||| ||| |||||| ||||||||||| || ||||| ||||| || ||||| |
|
|
| T |
389649 |
cacgggttcaagtcctggaaacaccctcttgtgtcaaaaaaacagggta----aggttgcgtacaatacaccaaa--tgatgggatccctttcctgaccc |
389742 |
T |
 |
| Q |
140 |
tgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
|||||||| | ||||||| |||||||| |
|
|
| T |
389743 |
tgcgtatgcgagagctttagtgcaccg |
389769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 116 - 176
Target Start/End: Complemental strand, 36486627 - 36486567
Alignment:
| Q |
116 |
atggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctt |
176 |
Q |
| |
|
||||||||||| ||||||||||| |||||||| |||||||| |||| ||| | ||||||| |
|
|
| T |
36486627 |
atggtgggacctcttcccggaccttgcgtatgcaggagctttagtgccccgggttgccctt |
36486567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 73; Significance: 2e-33; HSPs: 66)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 15 - 179
Target Start/End: Complemental strand, 30395885 - 30395724
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || ||||||||| || | ||||||| |||||||| ||||| | |||||||||||||| ||||||| |||||||||| |||||||||| |
|
|
| T |
30395885 |
taaagttgttgtcatgtgactttaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta----aggctgcgtacaatacaccaa |
30395790 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
||||||||||||||||||||||||| || |||| ||||||||| |||||||||| |||||||||| |
|
|
| T |
30395789 |
taatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgccctttta |
30395724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 10 - 163
Target Start/End: Original strand, 27201643 - 27201793
Alignment:
| Q |
10 |
aatgataaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaa-aaacagggtagggaaggctgcgtaaaatac |
108 |
Q |
| |
|
|||| |||||||| || ||||||||||||| | || |||| |||||||| ||||| | ||||||||| | |||||||||| |||||||||| ||||| |
|
|
| T |
27201643 |
aatggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtcagaaacagggta----aggctgcgtacaatac |
27201738 |
T |
 |
| Q |
109 |
accaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgca |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
27201739 |
accaaaaatggtgggaccccttcccggaccttgcgtatgcgggagctttagtgca |
27201793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 15 - 178
Target Start/End: Original strand, 18944644 - 18944805
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || ||||||||||||| | ||| ||| |||| ||| ||||| | |||||||||||||| ||||||| |||||||||| |||||||||| |
|
|
| T |
18944644 |
taaagttgttgtcatgtgactgaaaggtcacaggttcaaggcctggaaacagcctcttgtgtaaaaaacagggta----aggctgcgtacaatacaccaa |
18944739 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagc-tttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| ||| |||||||| | ||||||||| |
|
|
| T |
18944740 |
caatggtgggaccccttcccggaccctgcgtatgcgggagcttttagtgcaccgggttgccctttt |
18944805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 28 - 179
Target Start/End: Original strand, 10668239 - 10668387
Alignment:
| Q |
28 |
atgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaaaatggtgggacc |
126 |
Q |
| |
|
|||||||||||| | ||||||| |||||||| ||||| | |||||||||||||| || |||| ||| |||||| |||||||||| |||||||||||| |
|
|
| T |
10668239 |
atgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacaaggta----aggttgcgtacaatacaccaataatggtgggacc |
10668334 |
T |
 |
| Q |
127 |
ccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
||||||||| ||||||||||| ||||||||| |||||||| | |||||||||| |
|
|
| T |
10668335 |
ccttcccggtccctgcgtatgcgggagctttagtgcaccgggttgccctttta |
10668387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 27 - 158
Target Start/End: Original strand, 11596526 - 11596651
Alignment:
| Q |
27 |
catgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggacc |
126 |
Q |
| |
|
||||||||||||| | ||||||| |||||||||||||| |||||||||||||||||||| ||||||||||| |||||||| ||||||||||||| |
|
|
| T |
11596526 |
catgtgactgaaatgtcacgggttcaagtcctagaaacaacctcttgtgtaaaaacagggt----aaggctgcgtataatacacc--aaatggtgggacc |
11596619 |
T |
 |
| Q |
127 |
ccttcccggaccctgcgtatgagggagctttg |
158 |
Q |
| |
|
|||||| |||||||||||||| |||||||||| |
|
|
| T |
11596620 |
ccttcctggaccctgcgtatgcgggagctttg |
11596651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 30 - 179
Target Start/End: Original strand, 35005139 - 35005285
Alignment:
| Q |
30 |
gtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaaaatggtgggacccc |
128 |
Q |
| |
|
|||||||||| | ||||||| |||||| | |||| | |||||||||||||| ||||||| ||||||| || ||||||||||||||||||||||||| |
|
|
| T |
35005139 |
gtgactgaaaggtcacgggttcaagtcttgaaaacagcctcttgtgtaaaaaacagggta----aggctgcatacaatacaccaaaaatggtgggacccc |
35005234 |
T |
 |
| Q |
129 |
ttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
||||||||||||||||||| ||| ||||| |||||||| | |||||||||| |
|
|
| T |
35005235 |
ttcccggaccctgcgtatgcgggcgctttagtgcaccgggttgccctttta |
35005285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 15 - 179
Target Start/End: Complemental strand, 34725253 - 34725096
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||||||||||| | ||||||| |||||||| ||||| | ||||||||||||| ||||||| |||||||||| ||||||| ||| |
|
|
| T |
34725253 |
taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa-cagggta----aggctgcgtacaatacactaaa |
34725159 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||| | |||||||| | |||||||||| |
|
|
| T |
34725158 |
--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttta |
34725096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 15 - 178
Target Start/End: Complemental strand, 46248110 - 46247952
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || ||||||||||||| | ||||||| |||||| | ||||| | |||||||||||||| ||||||| || ||||||| |||||||||| |
|
|
| T |
46248110 |
taaagttgttgtcatgtgactgaaatgtcacgggttcaagtcttggaaacagcctcttgtgtaaaaaacagggta----agactgcgtacaatacaccaa |
46248015 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
| ||||||||||||||||||||||||||||||| ||||||||| ||| |||| | ||||||||| |
|
|
| T |
46248014 |
a--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgtaccgggttgccctttt |
46247952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 15 - 179
Target Start/End: Complemental strand, 20004249 - 20004088
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || |||||||||| || | ||||||| |||||||| ||||| | |||| ||||||||| || |||| |||||||||| |||||||||| |
|
|
| T |
20004249 |
taaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctctcgtgtaaaaaacaaggta----aggctgcgtacaatacaccaa |
20004154 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
||||||||||||||||||| ||||| || |||| ||||||||| |||||||| | |||||||||| |
|
|
| T |
20004153 |
taatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctttta |
20004088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 15 - 179
Target Start/End: Original strand, 27474282 - 27474440
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||||||||||| | ||| ||| |||||| | ||||| ||||||||||||||||||||| | | |||||||| ||||||| || |
|
|
| T |
27474282 |
taaagttgttgtcatgtgactgaaaggtcacaggttcaagtcttggaaacagtctcttgtgtaaaaacagggca----aagctgcgtacaatacactgaa |
27474377 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |||||||| |||||||||| |
|
|
| T |
27474378 |
--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgccctttta |
27474440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 15 - 177
Target Start/End: Complemental strand, 35117925 - 35117765
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaa-acagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || || |||||||||| | ||||||| |||||||| |||| | ||||||||||||| |||||||| |||||| ||| |||||||||| |
|
|
| T |
35117925 |
taaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaatagcctcttgtgtaaaatacagggta----aggctgtgtacaatacaccaa |
35117830 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgt-atgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
||||| ||||||||||||||||||||||||| ||| |||||||| |||||||| ||| |||||| |
|
|
| T |
35117829 |
aaatgatgggaccccttcccggaccctgcgtaatgcaggagctttagtgcaccgggcttcccttt |
35117765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 27 - 178
Target Start/End: Complemental strand, 38478425 - 38478281
Alignment:
| Q |
27 |
catgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggacc |
126 |
Q |
| |
|
||||||||||||| | ||||||| |||||||||||||| | ||||||||| |||||||||| ||||||||||| |||||||| ||||||||| ||| |
|
|
| T |
38478425 |
catgtgactgaaaggtcacgggttcaagtcctagaaacagcctcttgtgt-aaaacagggt----aaggctgcgtacaatacacc--aaatggtggaacc |
38478333 |
T |
 |
| Q |
127 |
ccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||| |||||||||| |||| ||||||| | |||||||| | ||||||||| |
|
|
| T |
38478332 |
ccttctcggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
38478281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 15 - 165
Target Start/End: Complemental strand, 32632713 - 32632569
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||| ||||||||| | ||||||| |||||||| ||||| | |||||||||||||||||||| ||||||||||| |||||||| | |
|
|
| T |
32632713 |
taaagttgttgtcatatgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggt----aaggctgcgtacaatacacc--a |
32632620 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcacc |
165 |
Q |
| |
|
||||||||||||||||||| ||||||| |||| |||||||| ||||||| |
|
|
| T |
32632619 |
aatggtgggaccccttcccaaaccctgcatatgcgggagcttgagtgcacc |
32632569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 15 - 166
Target Start/End: Original strand, 46991805 - 46991951
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || |||||||||| || | ||||||| |||||||| ||||| |||||||||||||| ||||||| |||||| ||| |||||||| | |
|
|
| T |
46991805 |
taaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggta----aggctgtgtacaatacaccga |
46991900 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
| ||||||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
46991901 |
a--tggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccg |
46991951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 92 - 177
Target Start/End: Original strand, 4349713 - 4349796
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |||||||| | |||||||| |
|
|
| T |
4349713 |
aaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
4349796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 92 - 166
Target Start/End: Complemental strand, 18742042 - 18741968
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| | ||||||| |||||||| |
|
|
| T |
18742042 |
aaggctgcgtacaatacaccaaaaatggtgggaccccttcccagaccctgcgtatgcgagagctttagtgcaccg |
18741968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 28 - 166
Target Start/End: Complemental strand, 35253329 - 35253198
Alignment:
| Q |
28 |
atgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccc |
127 |
Q |
| |
|
|||||||||||| ||||||| |||||||| ||||| | ||||||||||||| ||||||| |||||||||| ||||||||||| ||||||||||| |
|
|
| T |
35253329 |
atgtgactgaaagatcacgggttcaagtcctcgaaacagcctcttgtgtaaaa-cagggta----aggctgcgtacaatacaccaaa--tggtgggaccc |
35253237 |
T |
 |
| Q |
128 |
cttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
||||||||||||||| |||| ||||||| | |||||||| |
|
|
| T |
35253236 |
cttcccggaccctgcatatgcgggagctctagtgcaccg |
35253198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 92 - 166
Target Start/End: Complemental strand, 42304292 - 42304218
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
|||| |||||| ||||||| |||||||||||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
42304292 |
aaggttgcgtacaatacacaaaaaatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccg |
42304218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 15 - 165
Target Start/End: Original strand, 47214512 - 47214655
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||||||||||| | ||||||| |||||||| ||||| ||||||||| | |||||||||| |||| |||||| |||||||| | |
|
|
| T |
47214512 |
taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagtctcttgt-ttaaaacagggt----aaggttgcgtacaatacacc--a |
47214604 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcacc |
165 |
Q |
| |
|
||||||||||||||||||| |||||||| |||| ||||||| | ||||||| |
|
|
| T |
47214605 |
aatggtgggaccccttcccagaccctgcatatgcgggagctctagtgcacc |
47214655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 104 - 178
Target Start/End: Original strand, 50606488 - 50606562
Alignment:
| Q |
104 |
aatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| ||||||||| |||||||| | ||||||||| |
|
|
| T |
50606488 |
aatacaccaaaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt |
50606562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 15 - 179
Target Start/End: Original strand, 14617039 - 14617198
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaa-aacagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || ||||||||||||| | |||| || |||||||| ||||| | |||||||||||| |||| ||| |||| |||||| |||||||| |
|
|
| T |
14617039 |
taaagttgttgtcatgtgactgaaaggtcacgagttcaagtcctggaaacagcctcttgtgtaaataaca----aggtaaggttgcgtacaatacacc-- |
14617132 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||| ||||||||| |||||||| | | |||||||| |
|
|
| T |
14617133 |
aaatggtgggatcccttcccggaccctgcatatgcgggagctttagtgcaccgggttaccctttta |
14617198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 15 - 178
Target Start/End: Original strand, 6925101 - 6925259
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtaggg-aaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || |||||||||| || | ||||||| |||||||| |||| | |||||||||||||| ||||| ||||||||| | |||||||| | |
|
|
| T |
6925101 |
taaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaatagcctcttgtgtaaaaaa----tagggtaaggctgcggacaatacaccga |
6925196 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
| ||||||||||||||||||| ||||||||||| ||||||||| |||||||||| |||| |||| |
|
|
| T |
6925197 |
a--tggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgagttgccttttt |
6925259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 15 - 174
Target Start/End: Complemental strand, 18724702 - 18724549
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgta-aaaacagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || ||||||||||||| | ||||||| |||||||| ||||| | |||||||||| |||||||||| ||||||| ||| |||||||| |
|
|
| T |
18724702 |
taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggt----aaggctgtgtacaatacacc-- |
18724609 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccc |
174 |
Q |
| |
|
|||| ||||||||||||||||||||| | |||| ||||||||| ||||||| |||||||| |
|
|
| T |
18724608 |
aaatcttgggaccccttcccggaccctacatatgcgggagcttt-gtgcaccaagctgccc |
18724549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 15 - 179
Target Start/End: Original strand, 19414440 - 19414597
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||| ||||||||| | ||||||| ||||||||||||| | ||||| ||||||| |||| || |||||||||| ||||||||||| |
|
|
| T |
19414440 |
taaagttgttgtcatatgactgaaaggtcacgggttcaagtcctagaaagagcctcttatgtaaaa-caggtta----aggctgcgtacaatacaccaaa |
19414534 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
|||||||||||||||||| ||||||| |||| ||||||| | |||||||| | |||||||||| |
|
|
| T |
19414535 |
--tggtgggaccccttcccgtaccctgcatatgcgggagctctagtgcaccgggttgccctttta |
19414597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 92 - 147
Target Start/End: Complemental strand, 19932838 - 19932783
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatg |
147 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19932838 |
aaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatg |
19932783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 15 - 163
Target Start/End: Complemental strand, 23768477 - 23768334
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || |||||||||| || | ||| ||| |||||| | ||||| | |||||||||||||| ||||||| |||||||||| |||||||||| |
|
|
| T |
23768477 |
taaagttgttgtcatgtgactgtaaggtcacaggttcaagtcatggaaacagcctcttgtgtaaaaaacagggta----aggctgcgtacaatacaccaa |
23768382 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgca |
163 |
Q |
| |
|
| ||||||||| ||||||| ||||||||||||| ||||||||| ||||| |
|
|
| T |
23768381 |
a--tggtgggacaccttcccagaccctgcgtatgcgggagctttagtgca |
23768334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 44 - 166
Target Start/End: Original strand, 45402124 - 45402243
Alignment:
| Q |
44 |
acgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaagg-ctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgc |
142 |
Q |
| |
|
|||||| |||||||| ||||| | |||||||||||||||||||| ||| ||||||| ||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
45402124 |
acgggttcaagtcctggaaacagcctcttgtgtaaaaacagggttc--aagttctgcgtacaatacaccaaa--tggtgggaccccttcccagaccctgc |
45402219 |
T |
 |
| Q |
143 |
gtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
||||| ||||||||| |||||||| |
|
|
| T |
45402220 |
gtatgcgggagctttagtgcaccg |
45402243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 16 - 179
Target Start/End: Original strand, 9939463 - 9939624
Alignment:
| Q |
16 |
aaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaa-aaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
||||||| || ||||||||||||| | |||| || |||||||| ||||| ||||||| ||| ||||| |||| ||| ||||| ||||||||||| |
|
|
| T |
9939463 |
aaagttgttgtcatgtgactgaaaggtcacgagttcaagtcctggaaacaacctcttgtttaagaaacatggta----aggttgcgtgcaatacaccaaa |
9939558 |
T |
 |
| Q |
115 |
aatggtgggacccc-ttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||| ||||||||| |||||||| | | |||||||| |
|
|
| T |
9939559 |
aatggtgggacccccttctcggaccctgcgtatgcgggagctttagtgcaccgggttaccctttta |
9939624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 46 - 175
Target Start/End: Original strand, 22324925 - 22325049
Alignment:
| Q |
46 |
gggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgta |
145 |
Q |
| |
|
|||| |||||| | ||||| | ||||||||||||||||||||| ||||||| || ||||||||||||||||||| |||| ||||| |||||||||| |
|
|
| T |
22324925 |
gggttcaagtcttggaaacagcctcttgtgtaaaaacagggta----aggctgcatacaatacaccaaaaatggtggagccccgtcccg-accctgcgta |
22325019 |
T |
 |
| Q |
146 |
tgagggagctttggtgcaccgagctgccct |
175 |
Q |
| |
|
|| ||||||||| ||||||| |||||||| |
|
|
| T |
22325020 |
tgcgggagctttagtgcaccaggctgccct |
22325049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 97 - 179
Target Start/End: Complemental strand, 6983889 - 6983809
Alignment:
| Q |
97 |
tgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||| |||||||||||||| | ||||||||||||||||| |||||||||||| |
|
|
| T |
6983889 |
tgcgtacaatacaccaaa--tggtgggacccctttccggaccctgcgtaggcaggagctttggtgcaccgggctgccctttta |
6983809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 15 - 181
Target Start/End: Complemental strand, 41319963 - 41319802
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgta-aaaacagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || ||||||||||||| | ||| ||| ||||||| ||||| |||||||||||| |||||||||| ||||||||||| |||||||| |
|
|
| T |
41319963 |
taaagttgttgtcatgtgactgaaaggtcacaggtttaagtcctggaaacagtctcttgtgtaaaaaacagggt----aaggctgcgtacaatacacc-- |
41319870 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttttagg |
181 |
Q |
| |
|
||||| ||||||||||||||| ||||| | |||| ||||| || |||||| | | |||||||||||| |
|
|
| T |
41319869 |
aaatgatgggaccccttcccgaacccttcatatgcgggagtttcagtgcactgggttgcccttttagg |
41319802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 92 - 166
Target Start/End: Complemental strand, 31442473 - 31442400
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
|||| |||||| |||||||||||| ||||||||||||||||||||| ||| ||||| |||||||||||||||||| |
|
|
| T |
31442473 |
aaggatgcgtacaatacaccaaaa-tggtgggaccccttcccggacactgtgtatgtgggagctttggtgcaccg |
31442400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 12 - 166
Target Start/End: Complemental strand, 45812695 - 45812548
Alignment:
| Q |
12 |
tgataaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacacc |
111 |
Q |
| |
|
||||||||||| || ||||||||||||| | ||| ||| |||||||| |||| ||||||||||||||| |||||| ||||||| || |||||||| |
|
|
| T |
45812695 |
tgataaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctgaaaacagtctcttgtgtaaaag-agggta----aggctgcatacaatacacc |
45812601 |
T |
 |
| Q |
112 |
aaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
||| ||||||||||||||||| ||||||| |||| ||||||| | |||||||| |
|
|
| T |
45812600 |
aaa--tggtgggaccccttcccaaaccctgcatatgcgggagctctagtgcaccg |
45812548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 15 - 166
Target Start/End: Complemental strand, 2435944 - 2435797
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgt-aaaaacagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || || |||||||||| | ||||||| |||||||| ||||| | ||| ||||| ||||| |||||| || ||||||| |||||||||| |
|
|
| T |
2435944 |
taaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacagcctcctgtgtgaaaaatagggta----agcctgcgtacaatacaccaa |
2435849 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
|| |||||||||||||| ||| ||||| || ||| ||||||||| |||||||| |
|
|
| T |
2435848 |
aa-tggtgggacccctttccgtaccctccgcatgcgggagctttagtgcaccg |
2435797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 92 - 174
Target Start/End: Complemental strand, 10378818 - 10378738
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccc |
174 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||| ||||||||| |||| ||||||||| |||||||| ||||||| |
|
|
| T |
10378818 |
aaggctgcgtacaatacaccaaa--tggtgggaccccttcttggaccctgcatatgcgggagctttagtgcaccgggctgccc |
10378738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 96 - 178
Target Start/End: Original strand, 15505643 - 15505722
Alignment:
| Q |
96 |
ctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||||| |||||||||||| ||||||||| ||||||||| ||||| |||| |
|
|
| T |
15505643 |
ctgcgtacaatacaccaaa--tggtgggaccccttcccgaaccctgcgtatgcgggagcttt-gtgcaccgaactgccttttt |
15505722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 55 - 178
Target Start/End: Complemental strand, 31382330 - 31382213
Alignment:
| Q |
55 |
tcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagc |
154 |
Q |
| |
|
|||| ||||| | |||||||||||||||||| || |||||||||| ||||||||||| |||||||||||||||| ||||||||| |||| |||||| |
|
|
| T |
31382330 |
tcctggaaacagcctcttgtgtaaaaacaggata----aggctgcgtacaatacaccaaa--tggtgggaccccttcctggaccctgcatatgcgggagc |
31382237 |
T |
 |
| Q |
155 |
tttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||| || |||| | ||||||||| |
|
|
| T |
31382236 |
tttactgtaccgggttgccctttt |
31382213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 52 - 175
Target Start/End: Complemental strand, 15511271 - 15511150
Alignment:
| Q |
52 |
aagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcg--taaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatga |
148 |
Q |
| |
|
||||||| ||||| | |||||||||||||| ||||||| |||||||| || |||||||||||| |||||| ||||||||| |||||||||||||| |
|
|
| T |
15511271 |
aagtcctggaaaccgcctcttgtgtaaaaaacagggta----aggctgcggatacaatacaccaaaa-tggtggtaccccttcctggaccctgcgtatgt |
15511177 |
T |
 |
| Q |
149 |
gggagctttggtgcaccgagctgccct |
175 |
Q |
| |
|
| ||||||| |||||||| |||||||| |
|
|
| T |
15511176 |
gtgagctttagtgcaccgggctgccct |
15511150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 104 - 178
Target Start/End: Original strand, 19701657 - 19701730
Alignment:
| Q |
104 |
aatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||||||||||| ||||||||| ||||||| ||| ||||||| |
|
|
| T |
19701657 |
aatacaccaaaa-tggtggggccccttcccggaccctgcgtatgcgggagctttagtgcaccaggctaccctttt |
19701730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 4 - 178
Target Start/End: Original strand, 20036210 - 20036379
Alignment:
| Q |
4 |
tggctcaatgataaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaa |
103 |
Q |
| |
|
|||| ||||| |||||||| || ||||||||||||| | ||||||| |||||||| ||||| |||||||||||| | | | || ||| ||||| |
|
|
| T |
20036210 |
tggcgcaatggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacaaactcttgtgtaaagagaaag--ggtaagattgcgttc |
20036307 |
T |
 |
| Q |
104 |
aatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||||| |||| ||| |||||||| ||||| ||||| |
|
|
| T |
20036308 |
aatacaccaaa--tggtggaaccccttcccggaccctgcgtatgcaggag-ttttgtgcaccgggctgctctttt |
20036379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 92 - 179
Target Start/End: Complemental strand, 20999933 - 20999848
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
||||||||||| ||||||||||| || |||| |||||||| | |||||||||| | ||||||||| |||||||| |||||||||||| |
|
|
| T |
20999933 |
aaggctgcgtacaatacaccaaa--tgatggggccccttccggcaccctgcgtacgcgggagctttagtgcaccgggctgccctttta |
20999848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 114 - 178
Target Start/End: Original strand, 30555210 - 30555274
Alignment:
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| | ||||||| |||||||| |||| |||||| |
|
|
| T |
30555210 |
aaatggtgggaccccttcacggaccctgcgtatgcgagagctttagtgcaccgggctgacctttt |
30555274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 92 - 178
Target Start/End: Complemental strand, 1517394 - 1517310
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||| | ||||||||||||| |||||||| |||||||| | ||||||||| |
|
|
| T |
1517394 |
aaggctgcgtacaatacaccaat--tggtgggaccccttctcagaccctgcgtatgcaggagctttagtgcaccgggttgccctttt |
1517310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 92 - 178
Target Start/End: Complemental strand, 12126920 - 12126836
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||||| ||||||||||| | |||||||||||||||||||||||| |||| ||||||| | |||||| | | ||||||||| |
|
|
| T |
12126920 |
aaggctgcgtacaatacaccaaa--ttgtgggaccccttcccggaccctgcatatgcgggagctgtagtgcactgcgttgccctttt |
12126836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 92 - 178
Target Start/End: Original strand, 23796540 - 23796624
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||| |||||| ||||||||||| ||||| ||||||||||| |||||||| |||| |||||||| |||||||| ||||||||||| |
|
|
| T |
23796540 |
aaggttgcgtacaatacaccaaa--tggtgagaccccttcccagaccctgcatatgctggagctttagtgcaccgggctgccctttt |
23796624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 92 - 178
Target Start/End: Original strand, 43768214 - 43768298
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||| || |||||||||| ||||||||||||||||| |||||||||||| ||||||||| ||||||| ||||||||||| |
|
|
| T |
43768214 |
aaggctgcctacaatacaccaat--tggtgggaccccttcccagaccctgcgtatacgggagctttaatgcaccgggctgccctttt |
43768298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 17 - 178
Target Start/End: Original strand, 8197046 - 8197202
Alignment:
| Q |
17 |
aagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaaa |
115 |
Q |
| |
|
|||||| || ||||||||||||| | ||||||| |||||||| | || | |||||||||||||| || |||| ||||| |||| | ||||||||| |
|
|
| T |
8197046 |
aagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggtaattgcctcttgtgtaaaaaacatggta----aggctacgtacagtacaccaaa- |
8197140 |
T |
 |
| Q |
116 |
atggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||| |||||||||| ||||||||||||||| |||||||| ||| |||| | ||||||||| |
|
|
| T |
8197141 |
-tggtaggaccccttctcggaccctgcgtatgttggagctttagtgtaccgggttgccctttt |
8197202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 117 - 179
Target Start/End: Complemental strand, 33594191 - 33594129
Alignment:
| Q |
117 |
tggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||||| |||||| | ||| |||||||| |
|
|
| T |
33594191 |
tggtgggaccccttcccagaccctgcgtatgcgggagctttagtgcactgggctaccctttta |
33594129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 15 - 163
Target Start/End: Complemental strand, 17470503 - 17470361
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgta-aaaacagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || || ||||||||| | || |||| |||||||||||||| | |||||||||| |||||||||| ||||||||||| |||||||| | |
|
|
| T |
17470503 |
taaagttgttgtcacgtgactgaatggtcatgggttcaagtcctagaaacagcctcttgtgtaaaaaacagggt----aaggctgcgtacaatacacc-a |
17470409 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgca |
163 |
Q |
| |
|
|||| ||||||||| |||| | |||||||||| ||||||||| ||||| |
|
|
| T |
17470408 |
aaatagtgggacccgttcctg--acctgcgtatgtgggagctttagtgca |
17470361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 15 - 155
Target Start/End: Complemental strand, 25468420 - 25468285
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || ||||||| ||||| | || |||| |||||||| ||||| |||||||||||||| ||||||| ||| |||||| |||||||||| |
|
|
| T |
25468420 |
taaagttgttgtcatgtgattgaaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaatcagggta----aggttgcgtacaatacaccaa |
25468325 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagct |
155 |
Q |
| |
|
| |||| ||||| |||||| ||||||||||||| ||||||| |
|
|
| T |
25468324 |
a--tggttggacctcttcccagaccctgcgtatgcgggagct |
25468285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 114 - 166
Target Start/End: Complemental strand, 4587626 - 4587574
Alignment:
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |||||||| |||||||| |
|
|
| T |
4587626 |
aaatggtgggaccccttcccggaccctgcctatgcgggagcttcagtgcaccg |
4587574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 114 - 158
Target Start/End: Original strand, 30682907 - 30682951
Alignment:
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttg |
158 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
30682907 |
aaatggtgggaccccttcccggaccgtgcgtatgcgggagctttg |
30682951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 92 - 179
Target Start/End: Complemental strand, 19974158 - 19974072
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
|||| |||||| |||||||||||| || |||||||| ||||||||| || ||||| ||||||||| |||||| | |||||||||||| |
|
|
| T |
19974158 |
aaggttgcgtacaatacaccaaaa-tgatgggacccattcccggactctatgtatgcgggagctttagtgcacggggctgccctttta |
19974072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 15 - 142
Target Start/End: Complemental strand, 22930224 - 22930104
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||||||||||| | || |||| |||||||| ||||| | || ||||||||||||||||| |||| || | | |||||||| | |
|
|
| T |
22930224 |
taaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagccttttgtgtaaaaacagggt----aaggttgtg-acaatacacc--a |
22930132 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgc |
142 |
Q |
| |
|
|||||||||||||||||| ||||||||| |
|
|
| T |
22930131 |
aatggtgggaccccttcctggaccctgc |
22930104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 92 - 158
Target Start/End: Complemental strand, 44485192 - 44485128
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttg |
158 |
Q |
| |
|
||||||||||| ||||||||||| |||| ||||||||||||||| ||| |||||| |||||||||| |
|
|
| T |
44485192 |
aaggctgcgtacaatacaccaaa--tggttggaccccttcccggatcctacgtatgcgggagctttg |
44485128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 92 - 174
Target Start/End: Complemental strand, 39215042 - 39214961
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccc |
174 |
Q |
| |
|
||||||||||| |||| |||||| ||||||| ||||||||| |||||||||||| || |||||| |||||||| ||||||| |
|
|
| T |
39215042 |
aaggctgcgtacaatattccaaaa-tggtgggtccccttcccaaaccctgcgtatgtggaagctttagtgcaccgggctgccc |
39214961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 92 - 178
Target Start/End: Original strand, 50812015 - 50812099
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||| |||||| |||||||||||| |||||| ||||||||||| ||||||||||| ||||||||| ||||| | ||||||||||| |
|
|
| T |
50812015 |
aaggttgcgtacaatacaccaaaa-tggtgg-accccttcccgcgccctgcgtatgcgggagctttaatgcactgggctgccctttt |
50812099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 15 - 147
Target Start/End: Original strand, 25290164 - 25290300
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacg--gtctcttgtgtaaaaa-cagggtaggg-aaggctgcgtaaaatacac |
110 |
Q |
| |
|
|||||||| || ||||||||||||| | |||| || |||||| | ||||| | |||||||||||||| ||||||| || |||| || ||| ||||||| |
|
|
| T |
25290164 |
taaagttgttgtcatgtgactgaaaggtcacgtgttcaagtcttggaaacacagcctcttgtgtaaaaaacagggtaaggcaaggttgtgtacaatacac |
25290263 |
T |
 |
| Q |
111 |
caaaaatggtgggaccccttcccggaccctgcgtatg |
147 |
Q |
| |
|
|||||||| | |||||||||||| ||| |||| |||| |
|
|
| T |
25290264 |
caaaaatgataggaccccttcccagactctgcatatg |
25290300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 104 - 165
Target Start/End: Complemental strand, 45264471 - 45264411
Alignment:
| Q |
104 |
aatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcacc |
165 |
Q |
| |
|
|||||||||||| ||||||||||||||| | |||||||| |||| ||||||||| ||||||| |
|
|
| T |
45264471 |
aatacaccaaaa-tggtgggaccccttctcagaccctgcatatgcgggagctttagtgcacc |
45264411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 95 - 147
Target Start/End: Original strand, 6358199 - 6358250
Alignment:
| Q |
95 |
gctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatg |
147 |
Q |
| |
|
|||||||| || ||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
6358199 |
gctgcgtacaaaacaccaaaa-tggtgggaccccttcccagaccctgcgtatg |
6358250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 15 - 128
Target Start/End: Original strand, 33222985 - 33223093
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||||||||||| | ||||| | ||||| | ||||| | ||||||||||||||||| || |||| |||||| |||||||| || |
|
|
| T |
33222985 |
taaagttgttgtcatgtgactgaaaggtcacggatttaagtcatggaaacagcctcttgtgtaaaaacag----ggaaaggttgcgtacaatacacc-aa |
33223079 |
T |
 |
| Q |
115 |
aatggtgggacccc |
128 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
33223080 |
aatggtgggacccc |
33223093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 92 - 178
Target Start/End: Original strand, 35019305 - 35019388
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||| || |||||||||| ||||||||||||| ||| ||||||||||||| | ||||||| |||||||| |||||| |||| |
|
|
| T |
35019305 |
aaggctgcatacaatacaccaat--tggtgggacccct-cccagaccctgcgtatgcgagagctttagtgcaccgggctgccatttt |
35019388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 123 - 177
Target Start/End: Complemental strand, 25554796 - 25554742
Alignment:
| Q |
123 |
gaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
|||||||||||| |||||||||||| |||||| || |||||||| ||||||||| |
|
|
| T |
25554796 |
gaccccttcccgaaccctgcgtatgcgggagcattagtgcaccggactgcccttt |
25554742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 147
Target Start/End: Complemental strand, 3060031 - 3060003
Alignment:
| Q |
119 |
gtgggaccccttcccggaccctgcgtatg |
147 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3060031 |
gtgggaccccttcccggaccctgcgtatg |
3060003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 122 - 178
Target Start/End: Original strand, 16120819 - 16120875
Alignment:
| Q |
122 |
ggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||||||||| |||||| |||| ||||||||| |||||| ||||||||||| |
|
|
| T |
16120819 |
ggaccccttcccggcccctgcatatgcgggagctttaatgcaccaggctgccctttt |
16120875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 130 - 178
Target Start/End: Complemental strand, 50760287 - 50760239
Alignment:
| Q |
130 |
tcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||| |||||||||||| ||||||||| ||||||| ||||||||||| |
|
|
| T |
50760287 |
tcccgaaccctgcgtatgcgggagctttaatgcaccgggctgccctttt |
50760239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 72; Significance: 7e-33; HSPs: 76)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 15 - 178
Target Start/End: Original strand, 5648237 - 5648394
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || |||||||||| || | ||||||| |||||||| ||||| | ||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
5648237 |
taaagttgttgtcatgtgactgtaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggta----aggctgcgtacaatacaccaaa |
5648332 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| | | ||||||||| |
|
|
| T |
5648333 |
--tggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcactgggttgccctttt |
5648394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 15 - 176
Target Start/End: Complemental strand, 6430782 - 6430627
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||||||||||| | ||||||| |||||| | ||||| | ||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
6430782 |
taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcatggaaacagcctcttgtgtaaaaacagggta----aggctgcgtacaatacaccaaa |
6430687 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctt |
176 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||||| | |||||| | ||||||| |
|
|
| T |
6430686 |
--tggtgggaccacttcccggaccctgcgtatgcgggagctttagcgcaccgggttgccctt |
6430627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 15 - 179
Target Start/End: Original strand, 16911540 - 16911701
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || ||||||||| ||| | ||||||| |||||||||||||| | |||||||||| ||| ||||||| |||||||||| |||||||||| |
|
|
| T |
16911540 |
taaagttgttgtcatgtgacttaaaggtcacgggttcaagtcctagaaacagcctcttgtgtacaaatcagggta----aggctgcgtacaatacaccaa |
16911635 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||||||| || |||| | |||||||||| |
|
|
| T |
16911636 |
taatggtgggaccccttcccggaccctgcgtacgcgggagctttagtttaccgggttgccctttta |
16911701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 15 - 177
Target Start/End: Complemental strand, 44363289 - 44363130
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || ||||||||||||| | |||| || |||||||| |||| | ||| |||||||||| |||||||||| ||||||| || |||||| |
|
|
| T |
44363289 |
taaagttgttgtcatgtgactgaaaggtcacgagttcaagtcctgaaaacagcctcgtgtgtaaaaaacagggtaggg----ctgcgtacaacgcaccaa |
44363194 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| |||||||| | |||||||| |
|
|
| T |
44363193 |
aaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
44363130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 17 - 178
Target Start/End: Original strand, 54175043 - 54175201
Alignment:
| Q |
17 |
aagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaa-cggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaa |
115 |
Q |
| |
|
|||||| || ||||||||||||| | ||||| | |||||||| |||| | | ||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
54175043 |
aagttgttgtcatgtgactgaaatgtcacggattcaagtcctggaaaacagcctcttgtgtaaaaacagggta----aggctgcgtacaatacaccaaaa |
54175138 |
T |
 |
| Q |
116 |
atggtgggaccccttccc-ggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||||||||||| ||||||||| |||| ||||||||| |||||||| ||||||||||| |
|
|
| T |
54175139 |
-tggtgggaccccttccccggaccctgcatatgcgggagctttagtgcaccgggctgccctttt |
54175201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 77 - 178
Target Start/End: Complemental strand, 30352680 - 30352579
Alignment:
| Q |
77 |
aaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctt |
176 |
Q |
| |
|
|||||||||||| | || |||||||| |||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |||||||| | ||||||| |
|
|
| T |
30352680 |
aaaaacagggtaagtaaagctgcgtacaatacaccaaaaatggtgggaccccttctcggaccctgcgtatgcgggagctttagtgcaccgtgttgccctt |
30352581 |
T |
 |
| Q |
177 |
tt |
178 |
Q |
| |
|
|| |
|
|
| T |
30352580 |
tt |
30352579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 15 - 178
Target Start/End: Complemental strand, 16408760 - 16408600
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || |||||||||| || | ||||||| |||||||| ||||| | |||||||||||||| ||||||| || ||||||| |||||||||| |
|
|
| T |
16408760 |
taaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta----agactgcgtacaatacaccaa |
16408665 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||| |||||||||||||||| || |||| ||||||||| |||||||| | ||||||||| |
|
|
| T |
16408664 |
taatggtggaaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccctttt |
16408600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 15 - 178
Target Start/End: Original strand, 30639358 - 30639515
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || | ||||||||||| | ||| ||| |||||||| ||||| | ||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
30639358 |
taaagttgttgtcttgtgactgaaaggtcactggttcaagtcctggaaacagactcttgtgtaaaaacagggta----aggctgcgtacaatacaccaaa |
30639453 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||| |||||||||||||||||||| |||| ||||||||| |||||| | | ||||||||| |
|
|
| T |
30639454 |
--tggtgagaccccttcccggaccctgcatatgcgggagctttagtgcactgggttgccctttt |
30639515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 15 - 167
Target Start/End: Original strand, 54730227 - 54730377
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtaggg-aaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || |||||||| ||| | ||||||| |||||||||||||| | |||||||||||||| | |||| ||||||||||| |||||||||| |
|
|
| T |
54730227 |
taaagttgttgtcatgtgaccaaaaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaaaaa---taggataaggctgcgtataatacaccaa |
54730323 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccga |
167 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
54730324 |
taatgatggaaccccttcccggaccctgcgtatgcgggagctttagtgcaccga |
54730377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 109 - 179
Target Start/End: Complemental strand, 47482918 - 47482848
Alignment:
| Q |
109 |
accaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
47482918 |
accaaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttggtgcaacgagctgccctttta |
47482848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 15 - 147
Target Start/End: Complemental strand, 5306820 - 5306694
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||||||||||| | ||||||| |||||||| ||||| | ||||||||||||| |||||| |||| |||||| |||||||| | |
|
|
| T |
5306820 |
taaagttgatgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaatcagggt----aaggttgcgtacaatacacc--a |
5306727 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatg |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
5306726 |
aatggtgggaccccttcccggaccctgcgtatg |
5306694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 54 - 178
Target Start/End: Complemental strand, 20639777 - 20639657
Alignment:
| Q |
54 |
gtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgaggga |
152 |
Q |
| |
|
||||| ||||| | |||||||||||||| ||||||| |||||||||| |||||||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
20639777 |
gtcctggaaacagcctcttgtgtaaaaaacagggta----aggctgcgtacaatacaccaaaa-tggtgggaccccttcccggaccctgcgtatgcggga |
20639683 |
T |
 |
| Q |
153 |
gctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||| |||||||| | ||||||||| |
|
|
| T |
20639682 |
gctttagtgcaccgggttgccctttt |
20639657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 15 - 166
Target Start/End: Original strand, 40915807 - 40915952
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||||||| || | ||||||| |||||||| ||||| | |||||||||||||||| |||| |||||||||| ||||||||||| |
|
|
| T |
40915807 |
taaagttgttgtcatgtgactataaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacaaggta----aggctgcgtacaatacaccaaa |
40915902 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
40915903 |
--tggtgggagcccttcccggaccctgcgtatgcgggagcttcagtgcaccg |
40915952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 15 - 178
Target Start/End: Complemental strand, 47528685 - 47528529
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||||||||||| | ||| ||| |||||||| ||||| | ||||||||||||| ||||||| |||||||||| ||||||||||| |
|
|
| T |
47528685 |
taaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaa-cagggta----aggctgcgtacaatacaccaaa |
47528591 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||||| | |||||||| | ||||||||| |
|
|
| T |
47528590 |
--tggtgggaccccttcccggaccctgaatatgtgggagctctagtgcaccgggttgccctttt |
47528529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 15 - 178
Target Start/End: Complemental strand, 48598980 - 48598824
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||||||||||| | ||||||| |||||||| ||||| | ||||||||| |||||||||| ||||||||||| |||||||| | |
|
|
| T |
48598980 |
taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt-aaaacagggt----aaggctgcgtacaatacacc--a |
48598888 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||| |||||| | |||||||| | ||||||||| |
|
|
| T |
48598887 |
aatggtgggaccccttcccggaccatgcatatgccggagctctagtgcaccgggttgccctttt |
48598824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 15 - 177
Target Start/End: Original strand, 20224962 - 20225117
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||||||||||| | || |||| |||||||| ||||| ||||||||||||| ||||||| |||||||||| ||||||||||| |
|
|
| T |
20224962 |
taaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaa-cagggta----aggctgcgtacaatacaccaaa |
20225056 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||| | |||||||| | |||||||| |
|
|
| T |
20225057 |
--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt |
20225117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 15 - 178
Target Start/End: Original strand, 23501771 - 23501925
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || ||||||||||||| | ||||||| |||||| || | |||||||||||||| ||||||| ||| |||||| |||||||||| |
|
|
| T |
23501771 |
taaagttgttgtcatgtgactgaaaggtcacgggttcaagtc------acagcctcttgtgtaaaaaacagggta----aggttgcgtacaatacaccaa |
23501860 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||||||||| |||||||| | ||||||||| |
|
|
| T |
23501861 |
taatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt |
23501925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 15 - 178
Target Start/End: Complemental strand, 11054303 - 11054147
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||||||||||| | ||||||| |||||||| |||| ||||||||||| |||||||||| ||| ||||||| |||||||| | |
|
|
| T |
11054303 |
taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctgaaaacagtctcttgtgt-aaaacagggt----aagactgcgtacaatacacc--a |
11054211 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||| || ||||||||||||||||||| |||| ||||||| | |||||||| | ||||||||| |
|
|
| T |
11054210 |
aatggcggaaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
11054147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 29 - 175
Target Start/End: Complemental strand, 29208039 - 29207900
Alignment:
| Q |
29 |
tgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggacccc |
128 |
Q |
| |
|
||||||||||| | ||||||| |||||||| |||| | ||||||||||||| ||||||| |||||||||| ||||||||||| |||||||||||| |
|
|
| T |
29208039 |
tgtgactgaaaggtcacgggttcaagtcctggaaattgcctcttgtgtaaaa-cagggta----aggctgcgtacaatacaccaaa--tggtgggacccc |
29207947 |
T |
 |
| Q |
129 |
ttcccggaccctgcgtatgagggagctttggtgcaccgagctgccct |
175 |
Q |
| |
|
|||||||||||||| |||| ||||||| | |||||||| | |||||| |
|
|
| T |
29207946 |
ttcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
29207900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 92 - 177
Target Start/End: Original strand, 20225126 - 20225211
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||||||| || |||| ||||||||| |||||||| | |||||||| |
|
|
| T |
20225126 |
aaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcccttt |
20225211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 15 - 166
Target Start/End: Original strand, 21646942 - 21647090
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtaggg-aaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || |||||||||| || | ||| ||| |||||||| ||||| | |||||||||||||| ||||| ||||||||||| |||| ||||| |
|
|
| T |
21646942 |
taaagttgttgtcatgtgactggaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaaaa----tagggtaaggctgcgtacaatataccaa |
21647037 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
||||||||||||||||||| ||||| || |||| ||||||||| |||||||| |
|
|
| T |
21647038 |
taatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccg |
21647090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 92 - 178
Target Start/End: Complemental strand, 20908720 - 20908635
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||| |||||||||||| ||||||||| |||||| ||||||||||| |
|
|
| T |
20908720 |
aaggctgcgtacaatacaccaaaa-tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcacaaggctgccctttt |
20908635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 104 - 178
Target Start/End: Complemental strand, 33836560 - 33836486
Alignment:
| Q |
104 |
aatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| ||||||||| ||||| || | ||||||||| |
|
|
| T |
33836560 |
aatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggttgccctttt |
33836486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 15 - 178
Target Start/End: Original strand, 35567148 - 35567306
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || ||||| ||||||| | || |||| |||||| | ||||| | | |||||||||||| ||||||| |||||| ||| || ||||||| |
|
|
| T |
35567148 |
taaagttgttgtcatgtaactgaaaggtcatgggttcaagtcttggaaacagccacttgtgtaaaaaacagggta----aggctgtgtacaacacaccaa |
35567243 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
| |||||||||||||||||| ||||||||| || ||||||||| |||||||| ||||||||||| |
|
|
| T |
35567244 |
a--tggtgggaccccttcccgaaccctgcgtctgcgggagctttagtgcaccgggctgccctttt |
35567306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 92 - 179
Target Start/End: Complemental strand, 51865121 - 51865036
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
||||||||||| ||||||||||| ||||||| ||||||||||||||||||||||| ||||||||| ||||||| ||||||||||| |
|
|
| T |
51865121 |
aaggctgcgtacaatacaccaaa--tggtggggccccttcccggaccctgcgtatgcgggagctttattgcaccggactgccctttta |
51865036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 31 - 178
Target Start/End: Complemental strand, 9832452 - 9832312
Alignment:
| Q |
31 |
tgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggacccctt |
130 |
Q |
| |
|
||||||||| | ||||||| |||||||| |||| | ||||||||||||| ||||||| |||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
9832452 |
tgactgaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaa-cagggta----aggctgcgtacaatacaccaaa--tggtgggacccctt |
9832360 |
T |
 |
| Q |
131 |
cccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||||||| |||| ||| || | |||||||| | ||||||||| |
|
|
| T |
9832359 |
cccggaccctgcatatgcaggaactctagtgcaccgggttgccctttt |
9832312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 55 - 176
Target Start/End: Complemental strand, 7909397 - 7909281
Alignment:
| Q |
55 |
tcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatg-agggag |
153 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||| ||| |||||| ||||||||||| |||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
7909397 |
tcctggaaacagtctcttgtgtaaaaacagggta----aggttgcgtacaatacaccaaa--tggtgggaccccttcccgaaccctgcgtatgcggggag |
7909304 |
T |
 |
| Q |
154 |
ctttggtgcaccgagctgccctt |
176 |
Q |
| |
|
|||| ||||| || | ||||||| |
|
|
| T |
7909303 |
ctttagtgcatcgggttgccctt |
7909281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 92 - 177
Target Start/End: Complemental strand, 30690259 - 30690176
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
|||||||| || |||||||||| ||||||||||||||||||||||||||||||| ||||||||| ||||||| |||||||||| |
|
|
| T |
30690259 |
aaggctgcatacaatacaccaat--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggctgcccttt |
30690176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 115 - 177
Target Start/End: Complemental strand, 38755970 - 38755908
Alignment:
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |||||||| | |||||||| |
|
|
| T |
38755970 |
aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
38755908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 17 - 157
Target Start/End: Complemental strand, 17043549 - 17043414
Alignment:
| Q |
17 |
aagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaa-acagggtagggaaggctgcgtaaaatacaccaaaa |
115 |
Q |
| |
|
|||||| || || |||||||||| | ||| ||| |||||||| ||||| | ||||||||||||| |||||||| |||||||||| ||||||||||| |
|
|
| T |
17043549 |
aagttgttgtcaagtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaatacagggta----aggctgcgtacaatacaccaaa- |
17043455 |
T |
 |
| Q |
116 |
atggtgggaccccttcccggaccctgcgtatgagggagcttt |
157 |
Q |
| |
|
||||||||||||||||| |||||||| |||| |||||||| |
|
|
| T |
17043454 |
-tggtgggaccccttcccagaccctgcatatgctggagcttt |
17043414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 43 - 178
Target Start/End: Original strand, 47443963 - 47444093
Alignment:
| Q |
43 |
cacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctg |
141 |
Q |
| |
|
||||||| |||||||| ||||| | |||||| ||||||| ||||||| |||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
47443963 |
cacgggttcaagtcctggaaacagcctcttgcgtaaaaaacagggta----aggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctg |
47444056 |
T |
 |
| Q |
142 |
cgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
| |||| ||||||| |||||| | | ||||||||| |
|
|
| T |
47444057 |
catatgcaggagcttcagtgcactgggttgccctttt |
47444093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 114 - 177
Target Start/End: Original strand, 11394924 - 11394987
Alignment:
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||| |||||||| | |||||||| |
|
|
| T |
11394924 |
aaatggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
11394987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 114 - 177
Target Start/End: Original strand, 11404651 - 11404714
Alignment:
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||| |||||||| | |||||||| |
|
|
| T |
11404651 |
aaatggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
11404714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 15 - 178
Target Start/End: Complemental strand, 23580365 - 23580207
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || || |||||||||| | ||||||| ||||| ||||||| | |||||||||||||| ||||| |||| ||||||| ||||||||| |
|
|
| T |
23580365 |
taaagttgttgtcacgtgactgaaaggtcacgggttcaagttctagaaagagcctcttgtgtaaaaaacaggg----gaagactgcgtaggatacaccaa |
23580270 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|| ||| | ||||||||| ||||| || ||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
23580269 |
aa-tggcgagaccccttcttggacc-tgtgtatgtgggagctttagtgcaccgagctgccctttt |
23580207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 92 - 178
Target Start/End: Original strand, 25629101 - 25629185
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||| ||| ||||||||||| |||||||||||||||||||||||| | |||| ||||||||| |||||||| | ||||||||| |
|
|
| T |
25629101 |
aaggctgtgtacaatacaccaaa--tggtgggaccccttcccggaccctacatatgcgggagctttagtgcaccgggttgccctttt |
25629185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 92 - 178
Target Start/End: Complemental strand, 13256484 - 13256398
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||||| |||||||||| ||| |||||||||||||||| |||| || | || ||||||||| |||||||| | ||||||||| |
|
|
| T |
13256484 |
aaggctgcgtacaatacaccaataatagtgggaccccttcccgaaccccgcatctgcgggagctttagtgcaccgggttgccctttt |
13256398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 9 - 166
Target Start/End: Original strand, 19027820 - 19027972
Alignment:
| Q |
9 |
caatgataaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaata |
107 |
Q |
| |
|
||||| || ||||| || || |||||||||| | ||||||| |||||||| ||||| ||||||||||||| ||||||| |||||||||| |||| |
|
|
| T |
19027820 |
caatggtagagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacaacatcttgtgtaaaaaacagggta----aggctgcgtacaata |
19027915 |
T |
 |
| Q |
108 |
caccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
|||||| |||||||||||||| || ||| ||||||||| ||||||||| |||||||| |
|
|
| T |
19027916 |
caccaat--tggtgggacccctttccagactctgcgtatgtgggagctttagtgcaccg |
19027972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 4 - 174
Target Start/End: Original strand, 25343154 - 25343321
Alignment:
| Q |
4 |
tggctcaatgataaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgta |
102 |
Q |
| |
|
|||| ||||| |||||||| || || |||||||| | | ||| ||| ||||| || |||| |||||||||||||||| ||||||| |||||||||| |
|
|
| T |
25343154 |
tggcgcaatggtaaagttgttgtcacgtgactgataggtcacaggttcaagttctggaaatagtctcttgtgtaaaaaacagggta----aggctgcgta |
25343249 |
T |
 |
| Q |
103 |
aaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccc |
174 |
Q |
| |
|
||||||||||||| ||| ||||||||||| || |||||||||| | ||||||| | ||||| ||||||| |
|
|
| T |
25343250 |
caatacaccaaaaagggttggaccccttcctagatcctgcgtatgtgagagctttagagcacccggctgccc |
25343321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 27 - 158
Target Start/End: Original strand, 25463112 - 25463238
Alignment:
| Q |
27 |
catgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggacc |
126 |
Q |
| |
|
||||||||||||| | ||||||| |||||||| ||||| |||||||||||||| || | |||| |||||| || |||||||| |||||||||| |
|
|
| T |
25463112 |
catgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaactggga---aaggttgcgtacaacacaccaaa--tggtgggacc |
25463206 |
T |
 |
| Q |
127 |
ccttcccggaccctgcgtatgagggagctttg |
158 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| |
|
|
| T |
25463207 |
ccttcccggaccctgcatatgcgggagctttg |
25463238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 116 - 178
Target Start/End: Original strand, 32484307 - 32484369
Alignment:
| Q |
116 |
atggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||||||||| |||||||| | ||||||||| |
|
|
| T |
32484307 |
atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt |
32484369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 114 - 179
Target Start/End: Original strand, 14983906 - 14983971
Alignment:
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| ||| ||| | |||||||||| |
|
|
| T |
14983906 |
aaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttta |
14983971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 116 - 177
Target Start/End: Complemental strand, 40553998 - 40553937
Alignment:
| Q |
116 |
atggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||||||| |||||||| | |||||||| |
|
|
| T |
40553998 |
atggtgtgaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt |
40553937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 92 - 156
Target Start/End: Original strand, 49796849 - 49796911
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctt |
156 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
49796849 |
aaggctgcgtacaatacaccaaa--tggtgggaccccttcccgaaccctgcgtatgcgggagctt |
49796911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 96 - 164
Target Start/End: Original strand, 21489143 - 21489210
Alignment:
| Q |
96 |
ctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcac |
164 |
Q |
| |
|
||||||| ||| |||||||| |||||||||||||||||| |||||||||||| ||||||||| |||||| |
|
|
| T |
21489143 |
ctgcgtacaatgcaccaaaa-tggtgggaccccttcccgaaccctgcgtatgcgggagctttcgtgcac |
21489210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 94 - 178
Target Start/End: Complemental strand, 36816466 - 36816383
Alignment:
| Q |
94 |
ggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||| ||||||||||||| |||||||| |||||| |||||||| ||||| ||||||||| ||| |||| | ||||||||| |
|
|
| T |
36816466 |
ggctgcgtacaatacaccaaaaa-ggtgggactccttcctggaccctgtgtatgcgggagctttagtgtaccgggttgccctttt |
36816383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 114 - 178
Target Start/End: Original strand, 38786681 - 38786745
Alignment:
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||||||| | |||||||| | ||||||||| |
|
|
| T |
38786681 |
aaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
38786745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 15 - 166
Target Start/End: Complemental strand, 47441687 - 47441541
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || || |||||||||| | ||| ||| ||||||| |||||| ||||||| |||||||| ||||||| |||||| ||| |||||||||| |
|
|
| T |
47441687 |
taaagttgttgtcacgtgactgaaaggtcacaggttcaagtccaagaaacagtctcttttgtaaaaatcagggta----aggctgtgtacaatacaccaa |
47441592 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
| |||| |||||||||||||||||||| ||| | |||||||| || ||||| |
|
|
| T |
47441591 |
a--tggttggaccccttcccggaccctgagtaagcaggagctttcgtccaccg |
47441541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 11 - 158
Target Start/End: Complemental strand, 32478946 - 32478810
Alignment:
| Q |
11 |
atgataaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacac |
110 |
Q |
| |
|
|||||||||||| || |||||||| || | | ||| ||| |||||||| ||||| |||| |||||||||||||||| |||||| ||||||| |
|
|
| T |
32478946 |
atgataaagttgttgtcatgtgaccgagaggtcacaggttcaagtcctggaaacaacctctagtgtaaaaacagggta----aggctg-----aatacac |
32478856 |
T |
 |
| Q |
111 |
caaaaatggtgggaccccttcccggaccctgcgtatgagggagctttg |
158 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
32478855 |
caaa--tggtgggaccccttcccggacccagcgtatgcgggagctttg |
32478810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 115 - 178
Target Start/End: Complemental strand, 50555718 - 50555655
Alignment:
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||| ||| |||||||| ||||||||||| |
|
|
| T |
50555718 |
aatggtggaaccccttcccggaccctgcgtatgcaggagttttagtgcaccgggctgccctttt |
50555655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 97 - 163
Target Start/End: Original strand, 20405144 - 20405210
Alignment:
| Q |
97 |
tgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgca |
163 |
Q |
| |
|
|||||| ||||||| || ||||||||||||||||||||||||| || |||| ||||||||| ||||| |
|
|
| T |
20405144 |
tgcgtacaatacactaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgca |
20405210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 115 - 177
Target Start/End: Original strand, 25388249 - 25388311
Alignment:
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| |||||||| | |||||||| |
|
|
| T |
25388249 |
aatggtgggaccccttcccggaccctgcgtatgcatgagctttagtgcaccgggttgcccttt |
25388311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 113 - 174
Target Start/End: Original strand, 36589815 - 36589876
Alignment:
| Q |
113 |
aaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccc |
174 |
Q |
| |
|
|||||||||||||||||||| | ||||| ||||| |||||||||||||||||| ||||||| |
|
|
| T |
36589815 |
aaaatggtgggaccccttcctgaaccctatgtatgcgggagctttggtgcaccgggctgccc |
36589876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 95 - 166
Target Start/End: Original strand, 16494272 - 16494343
Alignment:
| Q |
95 |
gctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
||||| || |||||||||||||||||||||||| ||||| ||||||| ||||| || |||||| ||| |||| |
|
|
| T |
16494272 |
gctgcatacaatacaccaaaaatggtgggaccctttcccagaccctgtgtatgcggaagctttagtgtaccg |
16494343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 16 - 167
Target Start/End: Complemental strand, 30496476 - 30496332
Alignment:
| Q |
16 |
aaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaa |
115 |
Q |
| |
|
||||||| || || |||||||||| | |||| || |||||| | ||||| | |||||||||||| || ||||| ||||||| || ||||||||||| |
|
|
| T |
30496476 |
aaagttgttgtcacgtgactgaaaggtcacgtgttcaagtcatggaaacagcctcttgtgtaaacac-gggta----aggctgcatacaatacaccaaa- |
30496383 |
T |
 |
| Q |
116 |
atggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccga |
167 |
Q |
| |
|
||| ||||| |||||||||||| ||| ||||| |||||||| ||||||||| |
|
|
| T |
30496382 |
-tggggggactccttcccggaccgtgcttatgatggagctttagtgcaccga |
30496332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 127 - 178
Target Start/End: Original strand, 35532077 - 35532128
Alignment:
| Q |
127 |
ccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||| | ||||||||| |
|
|
| T |
35532077 |
ccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
35532128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 16 - 157
Target Start/End: Complemental strand, 49938746 - 49938613
Alignment:
| Q |
16 |
aaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaa |
115 |
Q |
| |
|
||||||| || || |||||||||| | ||| ||| |||||||| ||||| | ||||||||||||||| ||||| || ||| |||||||||||| |
|
|
| T |
49938746 |
aaagttgttgtcacgtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaaacggggtaaggt-------gtacaatacaccaaaa |
49938654 |
T |
 |
| Q |
116 |
atggtgggaccccttcccggaccctgcgtatgagggagcttt |
157 |
Q |
| |
|
||||||||||||||||| ||||||| |||| ||||||||| |
|
|
| T |
49938653 |
-tggtgggaccccttcccataccctgcatatgcgggagcttt |
49938613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 30 - 164
Target Start/End: Complemental strand, 41018935 - 41018807
Alignment:
| Q |
30 |
gtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggacccct |
129 |
Q |
| |
|
|||||||||| | ||||||| |||||||| ||||| ||||||||||||| |||||| ||||| |||| ||||||||||| | ||||||||||| |
|
|
| T |
41018935 |
gtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaattagggta----aggctacgtacaatacaccaaata--gtgggacccct |
41018842 |
T |
 |
| Q |
130 |
tcccggaccctgcgtatgagggagctttggtgcac |
164 |
Q |
| |
|
|||| |||| |||||||| || ||||| |||||| |
|
|
| T |
41018841 |
tcccagaccttgcgtatggaggggctttagtgcac |
41018807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 19027986 - 19028047
Alignment:
| Q |
117 |
tggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||| ||||||||||||| | |||| ||||||||| |||||||| ||||||||||| |
|
|
| T |
19027986 |
tggtgggactccttcccggaccccacttatgcgggagctttagtgcaccgggctgccctttt |
19028047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 104 - 157
Target Start/End: Complemental strand, 30581537 - 30581485
Alignment:
| Q |
104 |
aatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagcttt |
157 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
30581537 |
aatacaccaaaa-tggtgggaccccttcccggaccctgcatatgtaggagcttt |
30581485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 15 - 163
Target Start/End: Original strand, 37494829 - 37494972
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || |||| |||||||| | ||| ||| |||||||| ||||| |||||||||||||| ||||||| ||| ||| || |||| ||||| |
|
|
| T |
37494829 |
taaagttgttgccatgcgactgaaaggtcacaggttcaagtcctggaaacaacctcttgtgtaaaaaacagggta----aggttgcatacaatataccaa |
37494924 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgca |
163 |
Q |
| |
|
| |||||||||||||| | |||||||||||||| |||||||| ||||| |
|
|
| T |
37494925 |
a--tggtgggacccctttcgggaccctgcgtatgcaggagctttagtgca |
37494972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 116 - 157
Target Start/End: Original strand, 44718641 - 44718682
Alignment:
| Q |
116 |
atggtgggaccccttcccggaccctgcgtatgagggagcttt |
157 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
44718641 |
atggtgggaccccttcccagaccctgcgtatgcgggagcttt |
44718682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 114 - 178
Target Start/End: Original strand, 28494223 - 28494287
Alignment:
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||||||||||||||| || ||||| |||| ||||||| | |||||||| |||||| |||| |
|
|
| T |
28494223 |
aaatggtgggaccccttcccagatcctgcatatgcgggagctctagtgcaccgggctgccttttt |
28494287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 166
Target Start/End: Complemental strand, 39077948 - 39077807
Alignment:
| Q |
18 |
agttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaat |
117 |
Q |
| |
|
||||| || ||||||| ||||| | ||||||| |||||||| ||||| | ||||||||| |||||||||| |||| |||||| |||| ||| |||| |
|
|
| T |
39077948 |
agttgttgtcatgtgattgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt-aaaacagggt----aaggttgcgtacaatatacc--aaat |
39077856 |
T |
 |
| Q |
118 |
ggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
|||| ||| ||| ||||||||||| |||| ||||||| | |||||||| |
|
|
| T |
39077855 |
ggtgagacatctttccggaccctgcatatgcgggagctctagtgcaccg |
39077807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 114 - 174
Target Start/End: Original strand, 54967092 - 54967151
Alignment:
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccc |
174 |
Q |
| |
|
||||||||||||||||||||| ||||| | |||| ||||||||| |||||||| ||||||| |
|
|
| T |
54967092 |
aaatggtgggaccccttcccgtaccctacatatgcgggagcttt-gtgcaccgggctgccc |
54967151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 92 - 176
Target Start/End: Complemental strand, 8473705 - 8473621
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggacccctt-cccgga-ccctgcgtatgagggagctttggtgcaccgagctgccctt |
176 |
Q |
| |
|
|||||||| || ||||||||||| |||||||||||||| |||||| |||||| |||| ||||||||| |||||||| | ||||||| |
|
|
| T |
8473705 |
aaggctgcatacaatacaccaaa--tggtgggaccccttccccggacccctgcatatgcgggagctttagtgcaccgggttgccctt |
8473621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 92 - 178
Target Start/End: Complemental strand, 9987917 - 9987833
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||| || ||||||||||| |||||||||||||||| |||| ||| |||| ||||||||| ||||||| |||||| |||| |
|
|
| T |
9987917 |
aaggctgcatacaatacaccaaa--tggtgggaccccttccttgaccttgcatatgcgggagctttaatgcaccgggctgccttttt |
9987833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 81
Target Start/End: Original strand, 14590815 - 14590881
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa |
81 |
Q |
| |
|
|||||||| || ||||||||||||| | ||||| | |||||||||||||| | ||||||| |||||| |
|
|
| T |
14590815 |
taaagttgttgtcatgtgactgaaaggtcacggattcaagtcctagaaacagcctcttgtctaaaaa |
14590881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 96 - 157
Target Start/End: Original strand, 2813181 - 2813242
Alignment:
| Q |
96 |
ctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagcttt |
157 |
Q |
| |
|
||||||| |||||| ||| ||||||||||||| |||||| || |||||||| ||||||||| |
|
|
| T |
2813181 |
ctgcgtacaatacatcaataatggtgggaccctttcccgaacgatgcgtatgcgggagcttt |
2813242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 15 - 88
Target Start/End: Complemental strand, 17315455 - 17315382
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggta |
88 |
Q |
| |
|
|||||||| || ||||||||||||| | ||||||| ||| |||| ||||| |||||||||||||||| |||| |
|
|
| T |
17315455 |
taaagttgttgtcatgtgactgaaaggtcacgggttcaattcctcgaaacaacctcttgtgtaaaaacaaggta |
17315382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 97 - 146
Target Start/End: Complemental strand, 35894540 - 35894492
Alignment:
| Q |
97 |
tgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtat |
146 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||| | ||||||| |
|
|
| T |
35894540 |
tgcgtacaatacaccaaaa-tggtgggaccccttcccggatcatgcgtat |
35894492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 92 - 157
Target Start/End: Complemental strand, 39029144 - 39029080
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagcttt |
157 |
Q |
| |
|
||||||| ||| ||||||| |||| |||||||||| ||| ||||||||||| |||| ||||||||| |
|
|
| T |
39029144 |
aaggctgtgtacaatacacgaaaa-tggtgggaccactttccggaccctgcatatgcgggagcttt |
39029080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 27 - 88
Target Start/End: Complemental strand, 42164293 - 42164232
Alignment:
| Q |
27 |
catgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggta |
88 |
Q |
| |
|
||||||||||||| | ||||||| |||||| | ||||| ||||||||||||||||||||| |
|
|
| T |
42164293 |
catgtgactgaaaggtcacgggttcaagtcttggaaacaacctcttgtgtaaaaacagggta |
42164232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 122 - 158
Target Start/End: Complemental strand, 3580895 - 3580859
Alignment:
| Q |
122 |
ggaccccttcccggaccctgcgtatgagggagctttg |
158 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
3580895 |
ggaccccttcccggaccctgcatatgtgggagctttg |
3580859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 99 - 179
Target Start/End: Original strand, 7038111 - 7038189
Alignment:
| Q |
99 |
cgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
|||| |||||||||||| ||||||| | ||| |||||||||||||||| | |||||||| |||||| | | |||||||||| |
|
|
| T |
7038111 |
cgtacaatacaccaaaa-tggtggggcacctacccggaccctgcgtat-acggagctttagtgcactgggttgccctttta |
7038189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 114 - 154
Target Start/End: Complemental strand, 7385539 - 7385499
Alignment:
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagc |
154 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||| |||||| |
|
|
| T |
7385539 |
aaatggtgggaccctttcccggaccctgtgtatgcgggagc |
7385499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 115 - 147
Target Start/End: Original strand, 8820581 - 8820613
Alignment:
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatg |
147 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
8820581 |
aatggtgggaccccttcccagaccctgcgtatg |
8820613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 15 - 178
Target Start/End: Original strand, 30557 - 30713
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||||||||||| | ||| ||| |||||||| ||||| | ||||||||||||| |||||||||| ||||||| ||||||||||| |
|
|
| T |
30557 |
taaagttgttgtcatgtgactgaaaggtcaccggttcaagtcctggaaacagcctcttgtgtaaaa-cagggtaggg----ctgcgtacaatacaccaaa |
30651 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||| | |||||||| | ||||||||| |
|
|
| T |
30652 |
--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt |
30713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 27 - 177
Target Start/End: Original strand, 58967 - 59114
Alignment:
| Q |
27 |
catgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaaaatggtgggac |
125 |
Q |
| |
|
||||||||||||| | ||||||| |||||||| ||||| | ||||||| |||||| ||||||| || ||||||| |||||||||||||||||||||| |
|
|
| T |
58967 |
catgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggta----agactgcgtacaatacaccaaaaatggtgggac |
59062 |
T |
 |
| Q |
126 |
cccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
|||||||| ||| ||||||||| ||||||||| ||||| || | |||||||| |
|
|
| T |
59063 |
cccttcccagactctgcgtatgcgggagctttagtgcatcgggttgcccttt |
59114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0258 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: scaffold0258
Description:
Target: scaffold0258; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 15 - 178
Target Start/End: Complemental strand, 13180 - 13023
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||||||||||| | ||| ||| |||||||| ||||| | |||||| ||||||||| |||| |||||||||| |||||||| || |
|
|
| T |
13180 |
taaagttgttgtcatgtgactgaaaggtcaccggttcaagtcctggaaacagcctcttgcgtaaaaacaaggta----aggctgcgtacaatacaccgaa |
13085 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||| ||||| |||||||| | ||||||||| |
|
|
| T |
13084 |
--tggtgggaccccttcccagaccctgcgtatgcgggggctttagtgcaccgggttgccctttt |
13023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 53; Significance: 2e-21; HSPs: 4)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 15 - 178
Target Start/End: Original strand, 46809 - 46967
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtaggg-aaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || ||||||||| || | ||||||| ||||| || ||||| |||||||||||||| ||||| |||| |||||| |||||||||| |
|
|
| T |
46809 |
taaagttgttgtcatgtgactagaaggtcacgggttcaagtgctggaaacaacctcttgtgtaaaaaa----tagggtaaggttgcgtacaatacaccaa |
46904 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttt |
178 |
Q |
| |
|
| ||||||||||||||||||||||||||||||| ||||||||| |||||||| | ||||||||| |
|
|
| T |
46905 |
a--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt |
46967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 15 - 163
Target Start/End: Complemental strand, 24924 - 24786
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || ||||||||||||| | || |||| |||||| ||| | |||||||||||||| ||||||| |||||||||| || ||||||| |
|
|
| T |
24924 |
taaagttgttgtcatgtgactgaaaggtcatgggttcaagtc-----aacagcctcttgtgtaaaaaacagggta----aggctgcgtacaacacaccaa |
24834 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgca |
163 |
Q |
| |
|
| |||||||||||||||||| |||||||||||| ||||||||| ||||| |
|
|
| T |
24833 |
a--tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgca |
24786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 92 - 179
Target Start/End: Original strand, 43709 - 43795
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggacccc-ttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||| ||| |||||||||| |||| ||||||| | |||||| ||| |||||||||| |
|
|
| T |
43709 |
aaggctgcgtacaatacacc--aaatggtgggacccctttctcggaccctgcatatgcgggagctctagtgcactgagttgccctttta |
43795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #4
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 113 - 157
Target Start/End: Complemental strand, 46771 - 46727
Alignment:
| Q |
113 |
aaaatggtgggaccccttcccggaccctgcgtatgagggagcttt |
157 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
46771 |
aaaatggtgggaccccttcccagaccctgcgtatgcgggagcttt |
46727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 92 - 179
Target Start/End: Complemental strand, 48717 - 48632
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgccctttta |
179 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||||||||||| |||| ||||||| | |||||||| | |||||||||| |
|
|
| T |
48717 |
aaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttta |
48632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0311 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: scaffold0311
Description:
Target: scaffold0311; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 15 - 164
Target Start/End: Original strand, 10788 - 10932
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || |||||||||| || | ||||||| |||| || |||| |||||||||||||| |||||||||| |||||| |||||||||| |
|
|
| T |
10788 |
taaagttgttgtcatgtgactggaaggtcacgggttcaaggtctgaaaacaacctcttgtgtaaaaaacagggtaggg----ctgcgtccaatacaccaa |
10883 |
T |
 |
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcac |
164 |
Q |
| |
|
| ||||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
10884 |
a--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcac |
10932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187 (Bit Score: 45; Significance: 9e-17; HSPs: 2)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 15 - 147
Target Start/End: Complemental strand, 10205 - 10080
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||||||||||| | ||||||| |||||||| ||||| | ||||||||||||| ||| ||| || ||||||| ||||||||||| |
|
|
| T |
10205 |
taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa-cagagta----agactgcgtacaatacaccaaa |
10111 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatg |
147 |
Q |
| |
|
| |||||||||||||||||||||||| |||| |
|
|
| T |
10110 |
ta--gtgggaccccttcccggaccctgcatatg |
10080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 15 - 147
Target Start/End: Complemental strand, 20533 - 20408
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||||||||||| | ||||||| |||||||| ||||| | ||||||||||||| ||| ||| || ||||||| ||||||||||| |
|
|
| T |
20533 |
taaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa-cagagta----agactgcgtacaatacaccaaa |
20439 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatg |
147 |
Q |
| |
|
| |||||||||||||||||||||||| |||| |
|
|
| T |
20438 |
ta--gtgggaccccttcccggaccctgcatatg |
20408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0180 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: scaffold0180
Description:
Target: scaffold0180; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 92 - 166
Target Start/End: Complemental strand, 24216 - 24144
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccg |
166 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||||||||||| |||| ||||||| | |||||||| |
|
|
| T |
24216 |
aaggctgcgtacaatacaccaaa--tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccg |
24144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1176 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold1176
Description:
Target: scaffold1176; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 15 - 165
Target Start/End: Complemental strand, 1742 - 1599
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaa |
114 |
Q |
| |
|
|||||||| || ||||||||||||| | || |||| |||||||| |||| ||||||||||||| |||| || ||||||| || ||||||||||| |
|
|
| T |
1742 |
taaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctgaaaacaacctcttgtgtaaaa-caggata----aggctgcatacaatacaccaaa |
1648 |
T |
 |
| Q |
115 |
aatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcacc |
165 |
Q |
| |
|
|| |||||||||||||||||||| ||||||| ||||||||| ||||||| |
|
|
| T |
1647 |
--tgatgggaccccttcccggacccggcgtatgcgggagctttagtgcacc |
1599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0223 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: scaffold0223
Description:
Target: scaffold0223; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 28 - 165
Target Start/End: Original strand, 11122 - 11252
Alignment:
| Q |
28 |
atgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccc |
127 |
Q |
| |
|
|||||||||||| | ||||||| |||||||| ||||| | ||||||||||||| || ||| ||||||| || ||||||||||| ||||||||| | |
|
|
| T |
11122 |
atgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa-caaagta----aggctgcttacaatacaccaaa--tggtgggacac |
11214 |
T |
 |
| Q |
128 |
cttcccggaccctgcgtatgagggagctttggtgcacc |
165 |
Q |
| |
|
||||||||||||||| |||| ||||||| | ||||||| |
|
|
| T |
11215 |
cttcccggaccctgcatatgcgggagctctagtgcacc |
11252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 43 - 165
Target Start/End: Complemental strand, 72997 - 72879
Alignment:
| Q |
43 |
cacgggtccaagtcctagaaacg-gtctcttgtgtaaaaa-cagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccct |
140 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||||| || |||| ||||||| || ||||||||||| |||| | ||||||||||||| ||| |
|
|
| T |
72997 |
cacgggttcaagtcctagaaacaagtctcttgtgtaaaaaacacggta----aggctgcctacaatacaccaaa--tggtagtaccccttcccggaacct |
72904 |
T |
 |
| Q |
141 |
gcgtatgagggagctttggtgcacc |
165 |
Q |
| |
|
||||||| ||||||||| ||||||| |
|
|
| T |
72903 |
gcgtatgcgggagctttagtgcacc |
72879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0954 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0954
Description:
Target: scaffold0954; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 92 - 177
Target Start/End: Original strand, 3596 - 3679
Alignment:
| Q |
92 |
aaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccgagctgcccttt |
177 |
Q |
| |
|
||||||||||| |||||||| || || ||||||||||||||| |||||||||||| || |||||| |||||||||| | |||||| |
|
|
| T |
3596 |
aaggctgcgtataatacaccgaa--tgatgggaccccttcccgaaccctgcgtatgcggcagctttagtgcaccgagtttcccttt |
3679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0254 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0254
Description:
Target: scaffold0254; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 15 - 140
Target Start/End: Original strand, 4135 - 4258
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaa-acagggtagggaaggctgcgtaaaatacaccaa |
113 |
Q |
| |
|
|||||||| || |||||||||||| | ||||||| |||||||| ||||| ||||||||||||| ||||| || ||| |||||| |||||||||| |
|
|
| T |
4135 |
taaagttgttgttatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaatacaggata----aggttgcgtacaatacaccaa |
4230 |
T |
 |
| Q |
114 |
aaat-ggtgggaccccttcccggaccct |
140 |
Q |
| |
|
||| ||||||||||||||||||||||| |
|
|
| T |
4231 |
taattggtgggaccccttcccggaccct |
4258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 146
Target Start/End: Complemental strand, 35163 - 35048
Alignment:
| Q |
27 |
catgtgactgaaacgacacgggtccaagtcctagaaacggtctctt--gtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtggga |
124 |
Q |
| |
|
|||||||||| || | ||||||| |||||||| |||| ||||||| |||| |||||||||| ||||||||||| |||||||| ||||||||||| |
|
|
| T |
35163 |
catgtgactgtaaggtcacgggttcaagtcctgaaaacagtctcttgtgtgtgaaaacagggt----aaggctgcgtacaatacacc--aaatggtggga |
35070 |
T |
 |
| Q |
125 |
ccccttcccggaccctgcgtat |
146 |
Q |
| |
|
||| |||| ||| | ||||||| |
|
|
| T |
35069 |
ccctttcctggatcttgcgtat |
35048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 81
Target Start/End: Complemental strand, 226563 - 226497
Alignment:
| Q |
15 |
taaagttggtggcatgtgactgaaacgacacgggtccaagtcctagaaacggtctcttgtgtaaaaa |
81 |
Q |
| |
|
|||||||| || ||||||||||||| | ||||| | |||||||||||||| | ||||||| |||||| |
|
|
| T |
226563 |
taaagttgttgtcatgtgactgaaaggtcacggattcaagtcctagaaacagcctcttgtctaaaaa |
226497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0167 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0167
Description:
Target: scaffold0167; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 114 - 158
Target Start/End: Original strand, 23671 - 23715
Alignment:
| Q |
114 |
aaatggtgggaccccttcccggaccctgcgtatgagggagctttg |
158 |
Q |
| |
|
|||||||||||||||||||| |||| || ||||| |||||||||| |
|
|
| T |
23671 |
aaatggtgggaccccttcccagaccttgagtatgtgggagctttg |
23715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University