View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_310 (Length: 249)
Name: NF7829A_low_310
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_310 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 14 - 249
Target Start/End: Complemental strand, 28908388 - 28908153
Alignment:
| Q |
14 |
atggacatcactccatggctagctgcaggaggccagctgattgcttcccgtttcgagcagaatgatgttagaagtttattacctgtagaaagtgaggtaa |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28908388 |
atggccatcactccatggctagctgcaggaggccagctgattgcttcccgtttcgagcagaatgatgttagaagtttattacctgtagaaagtgaggtaa |
28908289 |
T |
 |
| Q |
114 |
aatctcttaaattggttgcagccctgtaacttcgttagttgcacatggtcataaatttttatccttagaatctatgaagcacctactctgacactgacac |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28908288 |
aatctcttaaattggttgcagccctgtaacttcgttagttgcacatggtcataaatttttatccttagaatctatgaagcacctactctgacactgacac |
28908189 |
T |
 |
| Q |
214 |
ctgtagttttgccatttacaattttttatttggagt |
249 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28908188 |
ctgtagttttgccatttacatttttttatttggagt |
28908153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 26 - 111
Target Start/End: Original strand, 11847812 - 11847897
Alignment:
| Q |
26 |
ccatggctagctgcaggaggccagctgattgcttcccgtttcgagcagaatgatgttagaagtttattacctgtagaaagtgaggt |
111 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||||||| ||||| |||||||| |||| ||| ||||||||||||||||||| |
|
|
| T |
11847812 |
ccatggctaggcgaaggaggccagctgattgcttcccgttttgagcaacatgatgttcgaagcttactacctgtagaaagtgaggt |
11847897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University