View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_317 (Length: 248)
Name: NF7829A_low_317
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_317 |
 | |
|
| [»] scaffold1075 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 17006248 - 17006016
Alignment:
| Q |
1 |
tatgacgcagaagattgtccttccaatatggaagttcaaagaatatgcttttcttcttccagattggagggtcatcttttgtagattgcctcttgccttt |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
17006248 |
tatgacgcaaaagattgtccttccaatatggaagttcaaagaatatgcttttcttcttctagattggagggtcatcttttgtagattgcctcttgcctgt |
17006149 |
T |
|
| Q |
101 |
ccnnnnnnnnnctggtttggagggtcaccttgtgtaggttgtttcttgccttttctttttcccaaccctgctttctttggctttttaccaaaaatgacct |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17006148 |
ccttttttt--ctggtttggagggtcaccttgtgtaggttgtttcttgccttttctttttcccaaccctgctttctttggctttttaccaaaaatgacct |
17006051 |
T |
|
| Q |
201 |
ttatgttttcaacctgttgaagaacttgatgtcca |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
17006050 |
ttatgttttcaacctgttgaagaacttgatgtcca |
17006016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1075 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: scaffold1075
Description:
Target: scaffold1075; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 2849 - 3050
Alignment:
| Q |
1 |
tatgacgcagaagattgtccttccaatatggaagttcaaagaatatgcttttcttcttccagattggagggtcatcttttgtagattgcctcttgccttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
2849 |
tatgacgcagaagattgtccttccaatatggaagttcaaagaatatgcttttcttcttccagattggagggtcatcttttgtagattgcctcttgcctgt |
2948 |
T |
|
| Q |
101 |
ccnnnnnnnnnctggtttggagggtcaccttgtgtaggttgtttcttgccttttctttttcccaaccctgctttctttggctttttaccaaaaatgacct |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2949 |
cc--tttttttctggtttggagggtcaccttgtgtaggttgtttcttgccttttctttttcccaaccctgctttctttggctttttaccaaaaatgacct |
3046 |
T |
|
| Q |
201 |
ttat |
204 |
Q |
| |
|
|||| |
|
|
| T |
3047 |
ttat |
3050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University