View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_318 (Length: 248)
Name: NF7829A_low_318
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_318 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 3 - 248
Target Start/End: Complemental strand, 3009569 - 3009324
Alignment:
| Q |
3 |
ccgcgggctggtgcagaattaatttgaactgttcctgtctccattgcatcacttatcaacattgctttgtttatgtctttcgtaaacacacatccctgtg |
102 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3009569 |
ccgcgagctggtgcagaattaatttgaactgttcctgtctccattgcatcacttatcaacattgctttgtttatgtctttcgtaaacacacatccctgtg |
3009470 |
T |
|
| Q |
103 |
tcacgcaaaataaaatattaatgatataattttttgtgccctgaaattttttaatgccgtttgacagagaatgcagtgacgagtatgttgtgacactctc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3009469 |
tcacgcaaaataaaatattaatgatataattttttgtgccctgaaaaatattaatgccgtttgacagagaatgcagtgaagagtatgttgtgacactctc |
3009370 |
T |
|
| Q |
203 |
aagtgaagtaatttctaaaataatttattgttttgtagaaaatggt |
248 |
Q |
| |
|
|||| ||||||||| |||||| |||| |||||||| |||||||||| |
|
|
| T |
3009369 |
aagtaaagtaatttataaaatcattttttgttttggagaaaatggt |
3009324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 9 - 100
Target Start/End: Original strand, 54725009 - 54725100
Alignment:
| Q |
9 |
gctggtgcagaattaatttgaactgttcctgtctccattgcatcacttatcaacattgctttgtttatgtctttcgtaaacacacatccctg |
100 |
Q |
| |
|
||||| |||||||| || ||||||||||||| |||||||||||||| |||| |||||||||||| || || || || |||||||||||||| |
|
|
| T |
54725009 |
gctggggcagaatttatctgaactgttcctgattccattgcatcactaatcatcattgctttgttgatatcctttgtgaacacacatccctg |
54725100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University