View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_321 (Length: 248)
Name: NF7829A_low_321
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_321 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 13 - 236
Target Start/End: Complemental strand, 31963920 - 31963699
Alignment:
| Q |
13 |
tggacatccattgatcttgatcagaccgcgacctctcttgcagtgggtaactgcaacggcgttcttcttccggccaaagcattgcacctgttccattttc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
31963920 |
tggacatccattgatcttgatcagaccgcgacctctcttgcagtgagtaactgcaacggcgttcttcttccgcccaaagcattgtacctgttccattttc |
31963821 |
T |
|
| Q |
113 |
ctcaccttcttctttccctctccgccgaaaccaattctagggtttcattcatcagtaactatatatatgacctccgatagggtgggttttttcaaaaata |
212 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31963820 |
ctcaccttcttctttccctctccgccgcaaccaattctagggtttcattcatcagtaagtatatatatgacctccgatagggtggg--ttttcaaaaata |
31963723 |
T |
|
| Q |
213 |
ctaaaatgcccctccaacaccaaa |
236 |
Q |
| |
|
|||||||||||||||||| ||||| |
|
|
| T |
31963722 |
ctaaaatgcccctccaactccaaa |
31963699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 13 - 146
Target Start/End: Original strand, 44750676 - 44750806
Alignment:
| Q |
13 |
tggacatccattgatcttgatcagaccgcgacctctcttgcagtgggtaactgcaacggcgttcttcttccggccaaagcattgcacctgttccattttc |
112 |
Q |
| |
|
|||||| ||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44750676 |
tggacagccattaatcttgatgagaccgcgacctctcttgcagtgggtaactgcaacggcgttcttcttccggccaaagcattgcacctgttccattttg |
44750775 |
T |
|
| Q |
113 |
ctcaccttcttctttccctctccgccgaaaccaa |
146 |
Q |
| |
|
|| | |||||||| |||||||||| |||||| |
|
|
| T |
44750776 |
ctga---gcttctttctctctccgccgtaaccaa |
44750806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 13 - 146
Target Start/End: Original strand, 44772744 - 44772874
Alignment:
| Q |
13 |
tggacatccattgatcttgatcagaccgcgacctctcttgcagtgggtaactgcaacggcgttcttcttccggccaaagcattgcacctgttccattttc |
112 |
Q |
| |
|
|||||| ||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44772744 |
tggacagccattaatcttgatgagaccgcgacctctcttgcagtgggtaactgcaacggcgttcttcttccggccaaagcattgcacctgttccattttg |
44772843 |
T |
|
| Q |
113 |
ctcaccttcttctttccctctccgccgaaaccaa |
146 |
Q |
| |
|
|| | |||||||| |||||||||| |||||| |
|
|
| T |
44772844 |
ctga---gcttctttctctctccgccgtaaccaa |
44772874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 22 - 111
Target Start/End: Complemental strand, 19985813 - 19985722
Alignment:
| Q |
22 |
attgatcttgatcagaccgcgacctctcttgc--agtgggtaactgcaacggcgttcttcttccggccaaagcattgcacctgttccatttt |
111 |
Q |
| |
|
|||||||||||| || || |||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19985813 |
attgatcttgatgaggccatgacctctcttgcgcagtgggtaactgcaacagcgttcttcttccggccaaagcattgcacctgttccatttt |
19985722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University