View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_325 (Length: 248)
Name: NF7829A_low_325
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_325 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 160
Target Start/End: Complemental strand, 40315176 - 40315018
Alignment:
| Q |
1 |
cgtcaatgatccttcgaaacccagctaacctaaatataatagaaatgaagggaatatgaatcttgaaaatagatgcaatggaacaaagggaaagttcata |
100 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40315176 |
cgtcaatgatacttcgaaaccaagctaacctaaatataatagaaatgaagggaatatgaatcttgaaaatagatgcaatggaac-aagggaaagttcata |
40315078 |
T |
|
| Q |
101 |
aaacaaaattaaggagcacgtcggcattcttctgttgttagagaaagtatcaaatgttgt |
160 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40315077 |
aaacaaacttaaggagcacgtcggcattcttctgttgttagagaaagtatcaaatgttgt |
40315018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 173 - 248
Target Start/End: Complemental strand, 40314957 - 40314882
Alignment:
| Q |
173 |
caatacatgggtaaaatagattcttgaatgagatacttattaggaacaatgtaactgtatagttgatatttgattg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40314957 |
caatacatgggtaaaatagattcttgaatgagatacttattaggaacaatgtgactgtatagttgatatttgattg |
40314882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University