View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_335 (Length: 247)
Name: NF7829A_low_335
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_335 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 146
Target Start/End: Original strand, 51901188 - 51901332
Alignment:
| Q |
1 |
tcaagctagtcaactagtattttacttaacggaatccatcattcatgggtcaccgaaataattttccatcatgcactttgttcaaaaaattagtttacca |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51901188 |
tcaagctagtcaactagtatcttacttaacggaatccatcattcatgggtcaccgaaataattttccatcatgcactttgttcaaaaaattagtttacca |
51901287 |
T |
|
| Q |
101 |
aacccctctttaacttacaatgctctcatgaagttaatctgcattc |
146 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
51901288 |
aacccctc-ttaacttacaatgctcttatgaagttaatctgcattc |
51901332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 168 - 207
Target Start/End: Original strand, 51901393 - 51901432
Alignment:
| Q |
168 |
taagactgaactttttaagatcacaaattttctactaata |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51901393 |
taagactgaactttttaagatcacaaattttctactaata |
51901432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 201 - 238
Target Start/End: Original strand, 51901445 - 51901482
Alignment:
| Q |
201 |
actaatagtagaaacgtggcaaccatcatgagtattat |
238 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
51901445 |
actactagtagaaacgtggcaaccatcatgagtattat |
51901482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University