View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7829A_low_348 (Length: 245)

Name: NF7829A_low_348
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7829A_low_348
NF7829A_low_348
[»] chr5 (2 HSPs)
chr5 (1-231)||(38990961-38991191)
chr5 (27-218)||(38954597-38954788)


Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 38990961 - 38991191
Alignment:
1 aattccaccatacacttgaccaggactaccagagagggaaatgctaaaagaagaacaggcagggttggcaatgacttcagaaggaacattatcaacattg 100  Q
    |||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
38990961 aattccaccatacacttgaccatgactaccagagaggaaaatgctaaaagaagaacatgcagggttggcaatgacttcagaaggaacattatcaacattg 38991060  T
101 ggattgacataagtgccagagagagacgtcatttggacaggtccttcaatagtgagtggtggggtatgggataacgagttgtgaatggtgatgtcagaga 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||    
38991061 ggattgacataagtgccagagagagacgtcatttggacaggtccttcaatagtgagtggtggggtatgagataacgagctgtgaatggtgatgtcagaga 38991160  T
201 caataccagaacctctcagcactgtgatgtc 231  Q
    |||||||| ||||||||||||||||||||||    
38991161 caataccaaaacctctcagcactgtgatgtc 38991191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 27 - 218
Target Start/End: Complemental strand, 38954788 - 38954597
Alignment:
27 taccagagagggaaatgctaaaagaagaacaggcagggttggcaatgacttcagaaggaacattatcaacattgggattgacataagtgccagagagaga 126  Q
    ||||||| ||| |||||||||||||||||  |  ||||||||  |||| ||||||||||||| |||||  |||||||||||  |||||||||||||||||    
38954788 taccagataggaaaatgctaaaagaagaatggttagggttggtgatgaattcagaaggaacagtatcagaattgggattgatgtaagtgccagagagaga 38954689  T
127 cgtcatttggacaggtccttcaatagtgagtggtggggtatgggataacgagttgtgaatggtgatgtcagagacaataccagaacctctca 218  Q
    | |||||| ||  |||||||||||||| ||||  |||| ||| |||  ||||||  | ||||| || | |||||||| ||| ||||||||||    
38954688 catcattttgatgggtccttcaatagttagtgcaggggaatgagatgtcgagttacggatggtaatattagagacaagaccggaacctctca 38954597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University