View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_349 (Length: 245)
Name: NF7829A_low_349
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_349 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 10 - 184
Target Start/End: Complemental strand, 44467732 - 44467548
Alignment:
| Q |
10 |
aataatatactgatttcatcttttgtagataaaggagatttgcagcttgttgttatggtcaccttgtaatcgcagttaccactccgtttagtctcattct |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44467732 |
aataaaatactgatttcatcttttgtagataaaggagatttgcagcttgttgctatggtcaccttgtaatcgcagttaccactccgtttagtctcattct |
44467633 |
T |
|
| Q |
110 |
gaaacatgcatgcatatataaccttttat--------------ttaaaatatgaaattaataataaatcattcatgcagtgactaaact |
184 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
44467632 |
gaaacat----gcatatataaccttttatttaagatgcattaattaaaatatgaaattaataataaatcattcatccagtgactaaact |
44467548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 185 - 225
Target Start/End: Original strand, 6314877 - 6314917
Alignment:
| Q |
185 |
aattaaaagcacacaagtggattgcaaaaagggacagaagt |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6314877 |
aattaaaagcacacaagtggattgcaaaaagggccagaagt |
6314917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University