View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_354 (Length: 244)
Name: NF7829A_low_354
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_354 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 19 - 149
Target Start/End: Complemental strand, 3091169 - 3091039
Alignment:
| Q |
19 |
caaatgagaggaagtctctcatattcaacctcaatttaaaaagcaacaacctctcattcagtcatgatttactcatgcaatttttatgcgacatcaatgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3091169 |
caaatgagaggaagtctctcatattcaagctcaatttaaaaaacaacaacctctcattcagtcatgatttacttatgcaatttttatgcgacatcaatgt |
3091070 |
T |
|
| Q |
119 |
caacaaggaccctttcaaaatggttgaaatc |
149 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |
|
|
| T |
3091069 |
caacaaggacccttgcaaaatggttgaaatc |
3091039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 160 - 244
Target Start/End: Complemental strand, 3090027 - 3089943
Alignment:
| Q |
160 |
ttgcatgtgtttccaagcttaatagtgagaaagtactaacaatttgttgcttttgatcaaccaatatttggtgagagagcaacaa |
244 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3090027 |
ttgcatgtgtttccaagcttaacagtgagaaagtactaacaattttttgcttttgatcaaccaatatttggtgagagagcaacaa |
3089943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University