View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_360 (Length: 243)
Name: NF7829A_low_360
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_360 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 19 - 227
Target Start/End: Complemental strand, 15861516 - 15861308
Alignment:
| Q |
19 |
aatatctgtggatttttagaaacttggagtggagaaagtcggcccttaggatagacttcgaatttgggagttgtcctagctcagtgcagaagctagctta |
118 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15861516 |
aatatttgtggatttttagaaacttggagtggagaaagtcggcccttaggatagacttcgaatttgggagttgtcctagctcagtgcagaagctagctta |
15861417 |
T |
|
| Q |
119 |
acaagttgtccaccatttataactcaatcaatgtgctatcattgatattgtggtgatgtgtagttgatgtggcctcaatagtggtcaaagaaatatccaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
15861416 |
acaagttgtccaccatttataactcaatcaatgtgctatcattgatattgtggtgatgtgtagttgatgtggcctccattgtggtcaaagaaatatccaa |
15861317 |
T |
|
| Q |
219 |
aattttgat |
227 |
Q |
| |
|
||||||||| |
|
|
| T |
15861316 |
aattttgat |
15861308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University