View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_363 (Length: 243)
Name: NF7829A_low_363
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_363 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 6 - 243
Target Start/End: Original strand, 49825101 - 49825337
Alignment:
| Q |
6 |
agatggacatcatcatacacccgcttcacagcttagttacgccatccatgcttcaagttgccatcagttatctcaactttaaacaacannnnnnnngtct |
105 |
Q |
| |
|
|||| |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
49825101 |
agatcgacatcatcagacacccgcttcacaacttagttacgccatccatgcttcaagttgccatcagttatctcgactttaaacaacattttttt-gtct |
49825199 |
T |
 |
| Q |
106 |
atgaacaaatccagatcagcaggatattcgtcattgtaatgttgtgaagagtcacaaattgattcatcagatgtccttttgaccgcatagttgcgccaat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
49825200 |
atgaacaaatccagatcagcaggatattcgccattgtaatgttgtgaagagtcacaaattgattcatcagatgtccttttgacagcatagttgcgccaat |
49825299 |
T |
 |
| Q |
206 |
tatgcattaagttcccacccgtaattccaaccttaaat |
243 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
49825300 |
tatgcattaagttcccatccgtaatttcaaccttaaat |
49825337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University