View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_369 (Length: 243)
Name: NF7829A_low_369
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_369 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 10 - 237
Target Start/End: Original strand, 8293621 - 8293848
Alignment:
| Q |
10 |
cgtgttaatttctctgattccagatattttgttgctgcgttttgtatagcgtccgtgtcatgtgcatttgatctccatataattaattgcatctctggtt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8293621 |
cgtgttaatttctctgattccagatattttgttgctgcgttttgtatagcgtccgtgtcatgtgcatttgatctccatataattaattgcatctctggtt |
8293720 |
T |
 |
| Q |
110 |
taggtgctannnnnnnaataacaaatgtagaatatcagtatgttaatagttaggttagtattgttttctctcgtgacgattaaattgattatcagtttct |
209 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8293721 |
taggtgctatttttttaataacaaatgtagaatattagtatgttaatagttaggttagtattgttttctctcgtgacgattaaattgattatcagtttct |
8293820 |
T |
 |
| Q |
210 |
gcaatgtacacgtttctattgtttttat |
237 |
Q |
| |
|
||||||||||||||||| |||||||||| |
|
|
| T |
8293821 |
gcaatgtacacgtttctgttgtttttat |
8293848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University