View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_371 (Length: 243)
Name: NF7829A_low_371
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_371 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 46; Significance: 2e-17; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 182 - 227
Target Start/End: Complemental strand, 30953556 - 30953511
Alignment:
| Q |
182 |
tctgcacttctcttcttcctcttccccttctacatcttcattctct |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30953556 |
tctgcacttctcttcttcctcttccccttctacatcttcattctct |
30953511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 56 - 96
Target Start/End: Complemental strand, 30953681 - 30953641
Alignment:
| Q |
56 |
gtcatccacgtgtgtaattcatttaccatgtcatatttaat |
96 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30953681 |
gtcatccacatgtgtaattcatttaccatgtcatatttaat |
30953641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 56 - 96
Target Start/End: Original strand, 28583736 - 28583776
Alignment:
| Q |
56 |
gtcatccacgtgtgtaattcatttaccatgtcatatttaat |
96 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
28583736 |
gtcatccatgtgtgtaattcatttaccacgtcatatttaat |
28583776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 56 - 96
Target Start/End: Original strand, 30952702 - 30952742
Alignment:
| Q |
56 |
gtcatccacgtgtgtaattcatttaccatgtcatatttaat |
96 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30952702 |
gtcatccacgtgtgtaattcatttaccacttcatatttaat |
30952742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University