View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_373 (Length: 243)
Name: NF7829A_low_373
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_373 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 14 - 167
Target Start/End: Original strand, 44173367 - 44173520
Alignment:
| Q |
14 |
atatataacatcggtgccttaacggtatataagcgctatccttaattttatactacaaatgtatgcacccaacaaaccgcagtattaccaacataacaaa |
113 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44173367 |
atatataacatcggtgccttaatagtatataaacgctatccttaattttatactacaaatgtatgcacccaacaaaccgcagtattaccaacatagcaaa |
44173466 |
T |
|
| Q |
114 |
tattcagaattttttcaatccatcccaccaaaaataaaatctatgcagcttttg |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44173467 |
tattcagaattttttcaatccatcccaccaaaaataaaatctatgcagcttttg |
44173520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 149 - 230
Target Start/End: Original strand, 44173535 - 44173616
Alignment:
| Q |
149 |
aaaatctatgcagcttttgagtatttagactgaatcacccttccaaagcaacctacacatgatccaaaattaaaatcatgat |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44173535 |
aaaatctatgcagcttttgagtatttagactgaatcacccttccaaagcaacctacacatgatccaaaattaaaatcatgat |
44173616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University