View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_379 (Length: 241)
Name: NF7829A_low_379
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_379 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 17 - 224
Target Start/End: Original strand, 42814306 - 42814513
Alignment:
| Q |
17 |
aatgatatctccttgctcttttttgtgatgtgatgcttcactctatgatgtattcttggtattccaaaggtgaatttcttaccaaggtaaatatctcact |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42814306 |
aatgatatctccttgctcttttttgtgatgtgatgcttcactctatgatgtattcttggtattccaaaggtgaatttcttaccaaggtaaatatctcact |
42814405 |
T |
|
| Q |
117 |
gccatcaaattttcaatttgattactatcagtccctaacttgaacatttacctcttttgttcacatctctaagtcactataattagtcttggatcctgat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42814406 |
gccatcaaattttcaatttgattactatcagtccctaacttgaacatttacctcttttgttcacatctctaagtcactataattagtcttggatcctgat |
42814505 |
T |
|
| Q |
217 |
ccctatga |
224 |
Q |
| |
|
|||||||| |
|
|
| T |
42814506 |
ccctatga |
42814513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University