View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_381 (Length: 240)
Name: NF7829A_low_381
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_381 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 21 - 219
Target Start/End: Original strand, 3675337 - 3675535
Alignment:
| Q |
21 |
atccccaagaatatcaatcacagctgcagttgtaggtcgaaatatattattcccagtgataagttcatgaatttgacgatacacttggcttcctgtgtat |
120 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3675337 |
atccccaacaaaatcaatcacagctgcagttgtaggtcgaaatatattattcccagtgataagttcatgaatttgacgatacacttggcttcctgtgtat |
3675436 |
T |
 |
| Q |
121 |
atacttgtaaaaaatgctaccacaagcaaatacctaagattnnnnnnnttattaattaaagttccatacaaattaaattttgacaaaaacccatcatat |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3675437 |
atacttgtaaaaaatgctaccacaagcaaatacctaagattaaaaaaattattaattaaagttccatacaaattaaattttgacaaaaacccatcatat |
3675535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University