View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_387 (Length: 239)
Name: NF7829A_low_387
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_387 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 35410249 - 35410029
Alignment:
| Q |
1 |
tgccgatcttaaaagaaggtaaagaagatagtttccttcatcaaagttttctgtgcaatgagcttggttttacttgttctttcatttgttctttcactaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35410249 |
tgccgatcttaaaagaaggtaaagaagatagtttccttcatcaaagttttctgctcaatgagcttggttttacttgttctttcatttgttctttcactaa |
35410150 |
T |
 |
| Q |
101 |
gtgaagaagataagatctaactatttattctttcnnnnnnnncagaggtttggcggttccagatgccactcagccacatggcattagactacttattgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
35410149 |
gtgaagaagataagatctaactatttattctttc-tttttttcagaggtttggcggttccagatgccactcggccacatggcattagactacttattgaa |
35410051 |
T |
 |
| Q |
201 |
gattatccttatgcggctgatg |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
35410050 |
gattatccttatgcggctgatg |
35410029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University