View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_392 (Length: 238)
Name: NF7829A_low_392
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_392 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 24 - 232
Target Start/End: Original strand, 20935449 - 20935663
Alignment:
| Q |
24 |
ggtcacccgcatgacggatttcaccttcaggagcaccgtgtgtcaactggttaggattgaaatgtggtcctaaataagatattcaagaagcaaacaatct |
123 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20935449 |
ggtcacccgcatgacggatttcatcttcaggagcaccgtgtgtcaactggttaggattgaaatgtggtcctaaataagatattcaagaagcaaacaatct |
20935548 |
T |
|
| Q |
124 |
tcacttcttcagtccaaccaaaccatag------nnnnnnnggtacaaaaaatggaaactaaggtcaggttacattacctgtcgagatacacccattggt |
217 |
Q |
| |
|
| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20935549 |
taacttcttcagtccaaccaaaccatagaaaaaaacataaaggtacaaaaaatggaaactaaggtcaggttacattacctgtcgagatacacccattggt |
20935648 |
T |
|
| Q |
218 |
ggtatcaccatactc |
232 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
20935649 |
ggtatcaccatactc |
20935663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University