View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7829A_low_397 (Length: 237)

Name: NF7829A_low_397
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7829A_low_397
NF7829A_low_397
[»] chr1 (1 HSPs)
chr1 (22-222)||(31253015-31253215)
[»] chr8 (1 HSPs)
chr8 (155-222)||(2684869-2684936)
[»] chr4 (1 HSPs)
chr4 (155-222)||(5478376-5478443)
[»] chr2 (1 HSPs)
chr2 (155-222)||(45008294-45008361)
[»] chr7 (1 HSPs)
chr7 (155-222)||(46004880-46004947)


Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 22 - 222
Target Start/End: Original strand, 31253015 - 31253215
Alignment:
Q  22 tatcacaacacagtcatattcatttgctccttgaatcaataaaattaaatctcaaatggcaaaacggttgggcatacctagggtgaggagagcccttgat 121  Q
    |||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  31253015 tatcacaacacattcatatttatttgctccttgaatcaataaaattaaatctcaaatggcacaacggttgggcatacctagggtgaggagagcccttgat 31253114  T
Q  122 aggcttctgcccgtacttcctccacgagtaatcatcaggagggatatccgcaagcttgttgctgatagcaggcaccttaattgatctcttcactctatgc 221  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  31253115 aggcttctgcccgtacttcctccacgagtaatcatcaggagggatatccgcaagcttgttgctgatagcaggcaccttaattgatctcttcactctatgc 31253214  T
Q  222 t 222  Q
    |    
T  31253215 t 31253215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 155 - 222
Target Start/End: Original strand, 2684869 - 2684936
Alignment:
Q  155 atcaggagggatatccgcaagcttgttgctgatagcaggcaccttaattgatctcttcactctatgct 222  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||    
T  2684869 atcaggagggatatccgcaagcttgttgctgatagcaggcaccttaatggatctattcactctatgct 2684936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 155 - 222
Target Start/End: Complemental strand, 5478443 - 5478376
Alignment:
Q  155 atcaggagggatatccgcaagcttgttgctgatagcaggcaccttaattgatctcttcactctatgct 222  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||    
T  5478443 atcaggagggatatccgcaagcttgttgctgatagcaggcaccttaatggatctattcactctatgct 5478376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 155 - 222
Target Start/End: Original strand, 45008294 - 45008361
Alignment:
Q  155 atcaggagggatatccgcaagcttgttgctgatagcaggcaccttaattgatctcttcactctatgct 222  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||    
T  45008294 atcaggagggatatccgcaagcttgttgctgatagcaggcaccttaatggatctattcactctatgct 45008361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 155 - 222
Target Start/End: Complemental strand, 46004947 - 46004880
Alignment:
Q  155 atcaggagggatatccgcaagcttgttgctgatagcaggcaccttaattgatctcttcactctatgct 222  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |||||||||||||    
T  46004947 atcaggagggatatctgcaagcttgttgctgatagcaggcaccttaatggatctattcactctatgct 46004880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University