View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_399 (Length: 236)
Name: NF7829A_low_399
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_399 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 11 - 236
Target Start/End: Complemental strand, 6318322 - 6318096
Alignment:
| Q |
11 |
gtgttagtttgttgccatttctgaactacagatgaattcaaaaaagcttgttagatt-----gttgcctgcatattcttagagtttaccattcataatcc |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6318322 |
gtgttagtttgttgccatttctgaactacagatgaattcaaaaaagcttgttagattatattgttgcctgcatattcttagagtttaccattcataatcc |
6318223 |
T |
|
| Q |
106 |
ttgttgtacgtgcagctgttgatgacagtaaaattaaattctctccacatcatgaaactgacctacatacgtttgaatttaaggtcatatgtcactatac |
205 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6318222 |
ttgttgt----gcagctgttgatgacagtaaaattaaattctctccacatgatgaaactgacctacatacgtttgaatttaaggtcatatttcactatac |
6318127 |
T |
|
| Q |
206 |
tcccagacttttatagcctcttgccattcaa |
236 |
Q |
| |
|
||||| ||||||||||||||||| ||||||| |
|
|
| T |
6318126 |
tcccaaacttttatagcctcttggcattcaa |
6318096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University