View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_409 (Length: 235)
Name: NF7829A_low_409
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_409 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 17 - 222
Target Start/End: Complemental strand, 11964891 - 11964686
Alignment:
| Q |
17 |
tcattgtgattttatggtttgtttccgttaatcggagatattttatgtcgatcagtcagtttgctgtctgttgaaccgtgttaagttatgactcagtttc |
116 |
Q |
| |
|
|||||||||||| |||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11964891 |
tcattgtgatttcatggtttgtttctgttaattggagatattttatgtcgatcagtcagtttgctgtctgttgaaccgtgttaagttatgactcagtttc |
11964792 |
T |
 |
| Q |
117 |
tcactcttagtcttctgatgtttgtttggttattccataatgtgatgcaaacaatgaatgactttggtgacaattatctttgaatcattgcctcccacat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11964791 |
tcactcttagtcttctgatgtttgtttggttattccataatgtgatgcaaacaatgaatgactttggtgacaattatctttgaatcattgcctcccacat |
11964692 |
T |
 |
| Q |
217 |
attgtt |
222 |
Q |
| |
|
|||||| |
|
|
| T |
11964691 |
attgtt |
11964686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University