View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_420 (Length: 233)
Name: NF7829A_low_420
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_420 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 3775918 - 3776134
Alignment:
| Q |
1 |
aatattcccccgaaaaacggattcattagaccggaagcactgcagattcatgtaccctatgttggggaagaaaagagtgatgaacattccatcaaatctt |
100 |
Q |
| |
|
|||||| ||| |||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3775918 |
aatatttcccagaaaaatggattcattagaccggaagcactgcggattcatgtaccctatgttggggaagaaaagagtgatgaacattccatcaaatctt |
3776017 |
T |
 |
| Q |
101 |
ctgacacatcaacaacgctgacagaagatgcagctgccagcagttctgttgaacaagttatgccaaattgtcaaagcttccaaccgcaagttccgtacta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3776018 |
ctgacacatcaacaacgctgacagaagatgcagctgccagcagttctgttgaacaagttatgccaaattgtcaaagcttccaaccacaagttccgtacta |
3776117 |
T |
 |
| Q |
201 |
tcccagtgccccttggc |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
3776118 |
tcccagtgccccttggc |
3776134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University