View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_426 (Length: 231)
Name: NF7829A_low_426
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_426 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 22270402 - 22270322
Alignment:
| Q |
1 |
ggtctaaagttggaactggtttggtttggagcttagtttatcttcatatttatgcggacgtagaaaaccttattttgttaa |
81 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
22270402 |
ggtctaaagtttgaactggtttggtttggagcttagtttatgttcatatttatgcggacgtaaaaaaccttattttgttaa |
22270322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 77 - 126
Target Start/End: Complemental strand, 22269345 - 22269296
Alignment:
| Q |
77 |
gttaacacttaattttatcagtagattgatatgcaaataatactttcctc |
126 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
22269345 |
gttaacacttaattttattagtagattggtatgcaaataatactttcctc |
22269296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University