View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_438 (Length: 230)
Name: NF7829A_low_438
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_438 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 68 - 230
Target Start/End: Complemental strand, 32813376 - 32813214
Alignment:
| Q |
68 |
gcagggatctatatgctgcttatgtagtcggaaacttaaggaagtgacttctttggacactggttagcagcaaattgcagacacatatcaagtatacttg |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32813376 |
gcagggatctatatgctgcttatgtagtcggaaacttaaggaagtgacttctttggacactggttagcagcaaattgcagacacatatcaagtatacttg |
32813277 |
T |
|
| Q |
168 |
taaatgtctatgaaaatcatcactttgatttgcttttcattctatcacgctatgctacaatga |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
32813276 |
taaatgtctatgaaaatcatcactttgatttgtttttcattctatcgcgctatgctacaatga |
32813214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 32813442 - 32813398
Alignment:
| Q |
1 |
ttttccattggtgatcaaatgattcatttagatttcatacatgaa |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32813442 |
ttttccattggtgatcaaatgattcatttagatttcacacatgaa |
32813398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University