View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_445 (Length: 230)
Name: NF7829A_low_445
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_445 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 2 - 230
Target Start/End: Complemental strand, 32928615 - 32928384
Alignment:
| Q |
2 |
tgttttctcgttttctgaatatatattttcttcatcgtagcgagcgagcgcgatcatgctgaaaaaatagaattattaatagattaaaatttacagttca |
101 |
Q |
| |
|
||||||||||||||||| ||||||||| | ||||||||||||||||||||||| || |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32928615 |
tgttttctcgttttctgtatatatattgttttcatcgtagcgagcgagcgcgaacacactgaaaaaattgaattattaatagattaaaatttacagttca |
32928516 |
T |
|
| Q |
102 |
aggagggattcgaaccctagtca---nnnnnnnnnnnnnnnnnatcacacaatacaacatgggtccaactccgttacagtcagcaatgctaatgggttca |
198 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32928515 |
aggagggattcgaaccctagtcatcttcttcttcttcttcttcttcacacaatacaacatgggtccaactccgttacagtcagcaatgctaatgggttca |
32928416 |
T |
|
| Q |
199 |
ccctgttttcctaacgccatttcttggtctga |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
32928415 |
ccctgttttcctaacgccatttcttggtctga |
32928384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 152 - 228
Target Start/End: Original strand, 1483268 - 1483344
Alignment:
| Q |
152 |
acaacatgggtccaactccgttacagtcagcaatgctaatgggttcaccctgttttcctaacgccatttcttggtct |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| ||| ||||| ||||||| |
|
|
| T |
1483268 |
acaacatgggtccaactccgttacagtcagcgatgctaatgggttcaccttgttttccaaactccattgtttggtct |
1483344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University