View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_446 (Length: 230)
Name: NF7829A_low_446
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_446 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 5e-89; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 11 - 216
Target Start/End: Complemental strand, 33339440 - 33339235
Alignment:
| Q |
11 |
ggacatcataatttgggcacacaacaaaaatggcagctacactactaaaagccgttatgcatggcttctttccctcaaagctacagtggctgatcctagt |
110 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33339440 |
ggacaccataatttgggctcacaacaaaaatggcagctacactactaaaagcggctatgcatggcttctttccctcaaagctacagtggcagatcctagt |
33339341 |
T |
|
| Q |
111 |
tctcatcattcatggacttggatttggagattgcaagttccggaaaaatataaatttctcatttggttagctagccacaatgcctcccctactttatcta |
210 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33339340 |
tctcatcattcatggatttggatttggagattgtaagttctggaaaaatataaatttctcatttggttagcttgccacaatgcctcccctactttatctt |
33339241 |
T |
|
| Q |
211 |
tgcttc |
216 |
Q |
| |
|
|||||| |
|
|
| T |
33339240 |
tgcttc |
33339235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 112 - 166
Target Start/End: Complemental strand, 55417300 - 55417246
Alignment:
| Q |
112 |
ctcatcattcatggacttggatttggagattgcaagttccggaaaaatataaatt |
166 |
Q |
| |
|
||||||| || ||| |||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
55417300 |
ctcatcagtcttggtcttggatttggacattgcaccttccggaaaaatataaatt |
55417246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 127 - 216
Target Start/End: Complemental strand, 10116216 - 10116127
Alignment:
| Q |
127 |
cttggatttggagattgcaagttccggaaaaatataaatttctcatttggttagctagccacaatgcctcccctactttatctatgcttc |
216 |
Q |
| |
|
||||||| ||||| ||||| |||| ||||||||||||||||||| | ||||| || | |||||||| || ||||| |||||| |||||| |
|
|
| T |
10116216 |
cttggatatggaggttgcaggttctggaaaaatataaatttctcgtatggtttacttgtcacaatgcttctcctaccttatctttgcttc |
10116127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University