View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_461 (Length: 229)
Name: NF7829A_low_461
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_461 |
 | |
|
| [»] scaffold0036 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0036 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 17 - 139
Target Start/End: Original strand, 23934 - 24056
Alignment:
| Q |
17 |
catcaagataacattatgtgcatgggctgctgtggttgttctgaaacagcggtccgtcnnnnnnnagattgtacgacttttggcagcacatggtacttgc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
23934 |
catcaagataacattatgtgcatgggctgttgtggttgttctgaaacagcggtccgtctttttttagattgtacgacttttggcagcacatggtacttgc |
24033 |
T |
|
| Q |
117 |
tgtggcggtggcttggtattgat |
139 |
Q |
| |
|
||||||| || |||||||||||| |
|
|
| T |
24034 |
tgtggcgatgtcttggtattgat |
24056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 17 - 126
Target Start/End: Original strand, 52401656 - 52401765
Alignment:
| Q |
17 |
catcaagataacattatgtgcatgggctgctgtggttgttctgaaacagcggtccgtcnnnnnnnagattgtacgacttttggcagcacatggtacttgc |
116 |
Q |
| |
|
|||||| |||||||||||||||| || | ||||||||||||||||||||||||| || |||||||||||||||||||||||| ||||||||| |
|
|
| T |
52401656 |
catcaatataacattatgtgcatatgcggttgtggttgttctgaaacagcggtccatcttttcttagattgtacgacttttggcagcacgtggtacttgt |
52401755 |
T |
|
| Q |
117 |
tgtggcggtg |
126 |
Q |
| |
|
|||||||||| |
|
|
| T |
52401756 |
tgtggcggtg |
52401765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University