View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_468 (Length: 229)
Name: NF7829A_low_468
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_468 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 107 - 229
Target Start/End: Complemental strand, 31097526 - 31097404
Alignment:
| Q |
107 |
acttattctcaatctttatccctttagagttctatatactgatcaaaggtagcaagaattcaaccgatcaacaattacctacacaagactaatcatgatc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31097526 |
acttattctcaatctttatccctttagagttctatatactgatcaaaggtagcaagaattcaaccgatcaacaattacctacacaagactaatcatgatc |
31097427 |
T |
|
| Q |
207 |
agttgattgtgtggaactaatga |
229 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
31097426 |
agttgattgtgtggaactaatga |
31097404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University