View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_481 (Length: 226)
Name: NF7829A_low_481
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_481 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 25 - 212
Target Start/End: Original strand, 19190111 - 19190298
Alignment:
| Q |
25 |
cctccggtgttcctaccggacgaaaaaatggttattctggtggtgggtttggtggaaatggtggttattatggaaataaggataataagtatcatgagag |
124 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19190111 |
cctccggtgttcctaccggacgaaaaaagggttattctggtggtgggtttggtggaaatggtggttattatggaaataaggataataagtatcatgagag |
19190210 |
T |
|
| Q |
125 |
tggttatgggggttatggtggtggtactacaggtggtggttacggtcttgataaccgatctaacagtgggtatgggggtggacgttct |
212 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
19190211 |
tggttatggacgttatggtggtggtactacaggtggtggttacggtcttgataaccgatctaacagtggttatggaggtggacgttct |
19190298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University