View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_499 (Length: 222)
Name: NF7829A_low_499
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_499 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 169 - 222
Target Start/End: Complemental strand, 31658677 - 31658624
Alignment:
| Q |
169 |
tttgaatttgagaatgtttatgaccagttaggattttgatggctatggatatgt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31658677 |
tttgaatttgagaatgtttatgaccagttaggattttgatggctatggatatgt |
31658624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 18 - 55
Target Start/End: Original strand, 31658521 - 31658558
Alignment:
| Q |
18 |
gacatcataagttaaacgatcaaataaatctcccatta |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31658521 |
gacatcataagttaaacgatcaaataaatctcccatta |
31658558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University