View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7829A_low_515 (Length: 218)
Name: NF7829A_low_515
Description: NF7829A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7829A_low_515 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 6 - 206
Target Start/End: Complemental strand, 45190894 - 45190694
Alignment:
| Q |
6 |
gatggacatcatgaccaccatgcttattcttaggtgaatcaaatgcatttgcgtttgcactgcaacnnnnnnnagattttggacaaagaggtaagagcca |
105 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
45190894 |
gatgaacatcatgaccaccatgcttattcttaggtgaatcaaatgcatttgcgtttgcactgcaactttttttagattttggacaaagaggtaagagcca |
45190795 |
T |
 |
| Q |
106 |
tgaagagaaacctctactttctttccaatctaaaggtctttttaaccacctaatatacatcactactagtaacaacaatgatatcacagccaacaccaaa |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45190794 |
tgaagagaaacctctactttctttccaatctaaaggtctttttaaccacctaatatacatcactactagtaacaacaatgatatcacagccaataccaaa |
45190695 |
T |
 |
| Q |
206 |
c |
206 |
Q |
| |
|
| |
|
|
| T |
45190694 |
c |
45190694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University